{"pk":41359,"title":"First Report of ‘Candidatus Liberibacter asiaticus’ associated with huanglongbing in the weeds Cleome rutidosperma, Pisonia aculeata and Trichostigma octandrum in Jamaica","subtitle":null,"abstract":"Citrus huanglongbing (HLB) also known as citrus greening is the most destructive disease of citrus worldwide.  Three species of the causal organism have been identified.  These are ‘Candidatus Liberibacter asiaticus’, ‘Ca. L. africanus’ and ‘Ca. L. americanus’ (Bové, 2006). In 2010 a survey of non-citrus plants was conducted on two major citrus producing farms in Clarendon and St Catherine in Jamaica.  This was to determine the possibility of the existence of non-citrus hosts of HLB.  A total of 120 plants belonging to 10 different species and nine families were collected over a period of two months.  The plants collected included weeds as well as non-citrus trees.  None of the plants collected exhibited any symptoms of HLB and at the time of sample collection, no citrus psyllids was observed on the plants.  DNA was extracted from plant samples using the method of Dellaporta et al. (1983) and analysed by PCR using the primer pair OI1 (5` GCGCGTATGCAATACGAGCGGCA3`) and OI2c (5`GCCTCGCGACTTCGCAACCCAT 3`). DNA obtained from a confirmed HLB infected citrus plant from Florida served as the positive control whereas DNA from a citrus plant uninfected by HLB was used as the negative control.","language":"en","license":{"name":"Creative Commons Attribution 4.0","short_name":"CC BY 4.0","text":"Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.","url":"https://creativecommons.org/licenses/by/4.0"},"keywords":[],"section":"Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing","is_remote":true,"remote_url":"https://escholarship.org/uc/item/8dw9c1f5","frozenauthors":[{"first_name":"S.","middle_name":"E.","last_name":"Brown","name_suffix":"","institution":"Department of Basic Medical Sciences, University of the West Indies Mona, Kingston 7, Jamaica","department":"None"},{"first_name":"A.","middle_name":"P.","last_name":"Oberheim","name_suffix":"","institution":"Department of Basic Medical Sciences, University of the West Indies Mona, Kingston 7, Jamaica","department":"None"},{"first_name":"A.","middle_name":"","last_name":"Barrett","name_suffix":"","institution":"Jamaica Citrus Protection Agency, Bog Walk, St Catherine, Jamaica","department":"None"},{"first_name":"W.","middle_name":"A.","last_name":"McLaughlin","name_suffix":"","institution":"Department of Basic Medical Sciences, University of the West Indies Mona, Kingston 7, Jamaica","department":"None"}],"date_submitted":"2014-12-20T02:52:31Z","date_accepted":"2014-12-20T02:52:31Z","date_published":"2014-01-01T00:00:00Z","render_galley":null,"galleys":[{"label":"","type":"pdf","path":"https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41359/galley/30958/download/"}]}