Article List
API Endpoint for journals.
GET /api/articles/?format=api&offset=25100
{ "count": 38438, "next": "https://eartharxiv.org/api/articles/?format=api&limit=100&offset=25200", "previous": "https://eartharxiv.org/api/articles/?format=api&limit=100&offset=25000", "results": [ { "pk": 54887, "title": "Cover", "subtitle": null, "abstract": "", "language": "en", "license": { "name": "", "short_name": "", "text": null, "url": "" }, "keywords": [], "section": "Forematter", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/6dj2d79x", "frozenauthors": [ { "first_name": "BUJC", "middle_name": "", "last_name": "Editors", "name_suffix": "", "institution": "", "department": "" } ], "date_submitted": "2014-02-07T00:17:40+01:00", "date_accepted": "2014-02-07T00:17:40+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/ucbclassics_bujc/article/54887/galley/41409/download/" } ] }, { "pk": 54911, "title": "Cover", "subtitle": null, "abstract": "", "language": "en", "license": { "name": "", "short_name": "", "text": null, "url": "" }, "keywords": [], "section": "Forematter", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/1qc0j9g6", "frozenauthors": [ { "first_name": "BUJC", "middle_name": "", "last_name": "Editors", "name_suffix": "", "institution": "", "department": "" } ], "date_submitted": "2014-09-05T05:07:33+02:00", "date_accepted": "2014-09-05T05:07:33+02:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/ucbclassics_bujc/article/54911/galley/41421/download/" } ] }, { "pk": 63765, "title": "Cover Art", "subtitle": null, "abstract": "Saya Woolfalk, video still from \"The Empathics,\" 2012.", "language": "en", "license": { "name": "", "short_name": "", "text": null, "url": "" }, "keywords": [], "section": "Front Matter", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/0q20j11m", "frozenauthors": [ { "first_name": "Reginald", "middle_name": "", "last_name": "Daniel", "name_suffix": "", "institution": "", "department": "" } ], "date_submitted": "2014-01-31T00:33:27+01:00", "date_accepted": "2014-01-31T00:33:27+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/jcmrs/article/63765/galley/48968/download/" } ] }, { "pk": 63761, "title": "Critical Mixed Race Studies: New Directions in the Politics of Race and Representation", "subtitle": null, "abstract": "\"Critical Mixed Race Studies: New Directions in the Politics of Race and Representation” was Andrew J. Jolivétte’s keynote address at the inaugural Critical Mixed Race Studies Conference, November 5, 2010, at DePaul University. Jolivétte posits critical mixed-race pedagogy as a model for developingintersectional coalitions across various categories of difference composed of a \"new American majority\" (people of color, queers, women, immigrants, and youth), which was in fact President Barack Obama’s 2012 winning coalition. This shifts racial formation and social change from binary constructions to more multivalent approaches to achieving human rights and social justice. Taken to a logical conclusion, mixed-race pedagogy could also serve as a similar organizing principle for international movements for equity and social justice.", "language": "en", "license": { "name": "", "short_name": "", "text": null, "url": "" }, "keywords": [ { "word": "miscegenation" }, { "word": "intermarriage" }, { "word": "racially mixed people" }, { "word": "mixed heritage" }, { "word": "multiracial identity" }, { "word": "mixed race identity" }, { "word": "mixed race studies" }, { "word": "critical mixed race studies" }, { "word": "multiracial studies" }, { "word": "critical multiracial studies" }, { "word": "postracial" }, { "word": "coalitions." } ], "section": "Article", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/62p3p25p", "frozenauthors": [ { "first_name": "Andrew", "middle_name": "J.", "last_name": "Jolivétte", "name_suffix": "", "institution": "San Francisco State University", "department": "" } ], "date_submitted": "2014-01-27T07:45:17+01:00", "date_accepted": "2014-01-27T07:45:17+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/jcmrs/article/63761/galley/48964/download/" } ] }, { "pk": 37741, "title": "De Lima, Paolo. Poesía y guerra interna en el Perú (1980-1992): A Study of Poets and Civil War in Peru", "subtitle": null, "abstract": "Review of Poesia y guerra interna en el Peru (2013) by Paolo de Lima", "language": "es", "license": { "name": "Copyright", "short_name": "Copyright", "text": "", "url": "https://escholarship.org/terms" }, "keywords": [], "section": "Reviews", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/4v922342", "frozenauthors": [ { "first_name": "Richard", "middle_name": "", "last_name": "Leonardo", "name_suffix": "", "institution": "Universidad Nacional Mayor de San Marcos", "department": "None" } ], "date_submitted": "2015-04-24T05:05:24+02:00", "date_accepted": "2015-04-24T05:05:24+02:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/mester/article/37741/galley/28459/download/" } ] }, { "pk": 41358, "title": "Detection of 16Sr IX phytoplasma (HLB phytoplasma) in Sunn Hemp (Crotalaria juncea) in São Paulo State, Brazil", "subtitle": null, "abstract": "In São Paulo State, besides the occurrence of \nCandidatus\n Liberibacter americanus and \nCa\n. L. asiaticus, a 16Sr IX group phytoplasma was associated with HLB symptoms, indistinguishable from those caused by liberibacters. This phytoplasma is called HLB phytoplasma and was found widespread in citrus orchards, although at low incidence. The same phytoplasma was found in Sunn Hemp (\nCrotalaria juncea\n) in 2008 and witches’-broom was commonly found associated with 16Sr group IX detection. The aim of this work was to assess the phytoplasma diversity in Sunn Hemp with emphasis at the detection of group 16Sr IX phytoplasma and to establish an association between the occurrence of HLB phytoplasma and symptoms. Sunn Hemp samples were harvested close to the blooming period. Plants were selected in the field when showing symptoms common to phytoplasma infection. We employed universal primers do amplify phytoplasmas in general and group specific primers for 16Sr group IX. PCR products were sequenced to allow grouping of phytoplasmas. We identified five phytoplasmas groups in 48 out of 99 Sunn Hemp plants, belonging to phytoplasma groups 16Sr I, III, VII, IX and XV. The most abundant phytoplasma was the group 16Sr IX, present in 70% of the samples, found in central and north São Paulo State. The occurrence of HLB phytoplasma in Sunn Hemp samples, showing 100% of similarity to the citrus phytoplasma, was highly related to virescence and the second most conspicuous symptom for this infection was witches’-broom.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/04f8q2t4", "frozenauthors": [ { "first_name": "L.", "middle_name": "F.", "last_name": "Bianco", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" }, { "first_name": "E.", "middle_name": "C.", "last_name": "Martins", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" }, { "first_name": "D.", "middle_name": "A.B.", "last_name": "Coletti", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" }, { "first_name": "R.", "middle_name": "S.", "last_name": "Toloy", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" }, { "first_name": "N.", "middle_name": "A.", "last_name": "Wulff", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" } ], "date_submitted": "2014-12-20T03:48:17+01:00", "date_accepted": "2014-12-20T03:48:17+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41358/galley/30957/download/" } ] }, { "pk": 41239, "title": "Detection of Candidatus Liberibacter asiaticus in Diaphorina citri caught on yellow sticky traps during the winter and summer of Sao Paulo State Brazil", "subtitle": null, "abstract": "The assessment of bacterialiferous Asian citrus psyllid (ACP) frequency is important in epidemiological and management studies because it can be related with the abundance of inoculum sources and with putative new HLB infections. For that, ACP can be collected directly or on yellow sticky traps (YST) commonly used by Brazilian growers to monitor psyllid population. The YST are usually left in the field for 2 weeks after which time YST are visually evaluated for the ACP presence, and if present, the psyllids are removed from the YST and tested by real-time PCR (qPCR) for liberibacter presence. Previous studies in Florida showed that the incidence of Las-positive ACP declined with increasing time on the YST (Irey et al., 2011). Thus, the objective of this work was to determine if time ACP is keep on YST affects qPCR results for Las and if it was related to weather conditions during winter and summer of Araraquara-SP (Brazil). ACP adults from nymphs reared on Las infected trees were placed on YST (BUG-Agentes Biológicos) in the field and 20 samples with 3 individuals were tested after 0, 1, 3, 9, 12 and 15 days. The results were compared with samples directly collected without trap glue. Experiments were done in June, July and August (winter) and in January, February and March (summer). In contrast with previous report in Florida, no difference on the incidence of Las-positive ACP samples was observed up to 15 days on the YST in both seasons.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/62p7x279", "frozenauthors": [ { "first_name": "I.", "middle_name": "", "last_name": "Sala", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" }, { "first_name": "E.", "middle_name": "C.", "last_name": "Martins", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" }, { "first_name": "D.", "middle_name": "A.B.", "last_name": "Coletti", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" }, { "first_name": "L.", "middle_name": "H.", "last_name": "Montesino", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" }, { "first_name": "R.", "middle_name": "B.", "last_name": "Bassanezi", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" }, { "first_name": "N.", "middle_name": "A.", "last_name": "Wulff", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" }, { "first_name": "D.", "middle_name": "C.", "last_name": "Texeira", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" } ], "date_submitted": "2014-11-20T01:12:36+01:00", "date_accepted": "2014-11-20T01:12:36+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41239/galley/30838/download/" } ] }, { "pk": 41330, "title": "Development of Symptom Expression and Presence of Candidatus Liberibacter asiaticus in Recently Infected, Mature Orange Trees", "subtitle": null, "abstract": "There have been limited studies and documentation of how long a mature Florida orange tree can remain commercially viable after expressing initial symptoms of the HLB disease. This study focuses on understanding the distribution and spread of HLB symptoms on newly symptomatic, mature trees and the association of these symptoms with the presence of the \nCandidatus \nLiberibacter asisticus (Las) bacterium in the various sectors of a tree. The investigation of this process will lead to a better understanding of how long HLB-infected trees can survive under conventional grove practices and, possibly, to better management decisions on tree elimination.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/98n8m9ts", "frozenauthors": [ { "first_name": "Timothy", "middle_name": "", "last_name": "Gast", "name_suffix": "", "institution": "Southern Gardens Citrus", "department": "None" }, { "first_name": "April", "middle_name": "", "last_name": "Russo", "name_suffix": "", "institution": "Southern Gardens Citrus", "department": "None" } ], "date_submitted": "2014-12-18T20:44:10+01:00", "date_accepted": "2014-12-18T20:44:10+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41330/galley/30929/download/" } ] }, { "pk": 41353, "title": "Differentiation of “Candidatus Liberibacter asiaticus” isolates from Brazil, China, and the United States", "subtitle": null, "abstract": "“\nCandidatus \nLiberibacter asiaticus” is associated with citrus Huanglongbing (HLB, yellow shoot disease), a highly destructive disease currently threatening world citrus production. HLB has a long history in China and was found in Brazil in 2004 and U.S.A. in 2005. There is an urgent need to differentiate isolates of “\nCa. \nL. asiaticus” from different geographical regions for effective control of HLB. In this study, isolates of “\nCa. \nL. asiaticus” collected from Brazil, China and the United States were evaluated based on two previously characterized genomic loci, one locus (\ntrn\n1) with variable tandem repeat numbers (TRNs), and the other locus (\nsnp\n1) is characteristic in single nucleotide polymorphisms (SNPs). A total of 299 strains (84 Brazil, 132 China and 83 U.S.) were analyzed. At the \ntrn\n1 locus, “\nCa. \nL. asiaticus” strains were divided into TRN-A and TRN-B groups. TRN-A isolates dominated the China and U.S. populations but were not detected in the Brazil isolates. In contrast, TRN-B dominated the Brazil isolates but occurred at low frequencies in China (3%) and U.S. (6%). SNP Analyses at the \nsnp\n1 locus established Term-A and Term-G groups. Term-A group included all Brazil and China isolates, along with 6% U. S. isolates which were also TRN-B isolates. The remaining (94%) U. S. isolates were in Term-G group. By combining data from the analyses of the two genomic loci, it is shown that the TRN-A:Term A genotype was unique to China, TRN-A:Term-G genotype was unique to U.S., and the TRN-B:Term-A genotype dominated the Brazil isolates. No TRN-B:Term-B isolates were found.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/78t0x6n6", "frozenauthors": [ { "first_name": "X.", "middle_name": "", "last_name": "Deng", "name_suffix": "", "institution": "Laboratory of Citrus Huanglongbing Research, South China Agricultural University, Guangzhou, Guangdong, People’s Republic of China", "department": "None" }, { "first_name": "J.", "middle_name": "", "last_name": "Chen", "name_suffix": "", "institution": "United States Department of Agriculture, Agricultural Research Services, San Joaquin Valley Agricultural Sciences Center, Parlier, California, U.S.A.", "department": "None" }, { "first_name": "S.", "middle_name": "", "last_name": "Lopes", "name_suffix": "", "institution": "Fundecitrus, São Paulo, Brazil", "department": "None" }, { "first_name": "X.", "middle_name": "", "last_name": "Wang", "name_suffix": "", "institution": "South-West University, Beibei, Chongqing, People’s Republic of China", "department": "None" } ], "date_submitted": "2014-12-20T03:35:44+01:00", "date_accepted": "2014-12-20T03:35:44+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41353/galley/30952/download/" } ] }, { "pk": 41254, "title": "Dispersal Behavior of Diaphorina citri Kuwayama (Hemiptera: Psyllidae) Under Laboratory Conditions", "subtitle": null, "abstract": "Asian citrus psyllid (ACP), \nDiaphorina citri\n Kuwayama, is the vector of huanglongbing (HLB), the most devastating disease of citrus worldwide. Knowledge of ACP dispersal behavior in locating host plants may contribute to our understanding of the spread of HLB within and between citrus trees. We conducted research in laboratory to evaluate ACP host plant finding behavior. In a free-choice situation, ACP adults initially settled at equal rates among seedlings of \nRhododendron simsii\n (non host plant for ACP), \nMurraya panciculata\n and \n“\nLugan”\nCitrus reticulata\n. However, at 18 and 42 h after ACP were released, the mean number of adults per plant on \nR. simsii\n was significantly lower than on \nC. reticulata\n and \nM. paniculata\n, respectively. Numbers of adults on \nC. reticulata\n and \nM. paniculata\n remained statistically equivalenty until 90 h after releases. Within a plant, the ratio of ACP adults on new flush shoots did not significantly increased in comparison to other parts of the tree during 1-4 d after the psyllids were released. Even on 7th day after ACP release, about 30 % adults were observed on plant locations other than flushing shoots. The results indicated that ACP adults differentiated between host and non-host plants faster than they differentiated between different parts of a host plant.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/4q36c4zv", "frozenauthors": [ { "first_name": "Chuanqing", "middle_name": "", "last_name": "Ruan", "name_suffix": "", "institution": "Fujian Academy of Agricultural Sciences, Fuzhou, Fujian 350003, China", "department": "None" }, { "first_name": "Bo", "middle_name": "", "last_name": "Liu", "name_suffix": "", "institution": "Fujian Academy of Agricultural Sciences, Fuzhou, Fujian 350003, China", "department": "None" }, { "first_name": "Zhenquan", "middle_name": "", "last_name": "Wu", "name_suffix": "", "institution": "Fujian Agriculture and Forestry University, Fuzhou, Fujian 350002, China", "department": "None" }, { "first_name": "Tao", "middle_name": "", "last_name": "Li", "name_suffix": "", "institution": "Fujian Agriculture and Forestry University, Fuzhou, Fujian 350002, China", "department": "None" }, { "first_name": "Hanqing", "middle_name": "", "last_name": "Hu", "name_suffix": "", "institution": "Fujian Academy of Agricultural Sciences, Fuzhou, Fujian 350003, China", "department": "None" }, { "first_name": "Guocheng", "middle_name": "", "last_name": "Fan", "name_suffix": "", "institution": "Fujian Academy of Agricultural Sciences, Fuzhou, Fujian 350003, China", "department": "None" }, { "first_name": "Yongping", "middle_name": "", "last_name": "Duan", "name_suffix": "", "institution": "USDA-ARS, 2001 South Rock Road, Fort Pierce, FL 34945 USA", "department": "None" }, { "first_name": "David", "middle_name": "G.", "last_name": "Hall", "name_suffix": "", "institution": "USDA-ARS, 2001 South Rock Road, Fort Pierce, FL 34945 USA", "department": "None" } ], "date_submitted": "2014-11-25T20:34:29+01:00", "date_accepted": "2014-11-25T20:34:29+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41254/galley/30853/download/" } ] }, { "pk": 41259, "title": "Disrupt the bacterial growth in the insect vector to block the transmission of Candidatus Liberibacter asiaticus to citrus, the causal agent of citrus greening disease", "subtitle": null, "abstract": "The genome of \nCandidatus\n Liberibacter asiaticus (CLas) reveals the presence of luxR, encodingLuxR protein, one of a two component cell-to-cell communication system. However, the genome lacks the second component, luxl, that produces acyl-homoserine lactones (AHLs), suggesting that CLas has a solo LuxR system. Interestingly, we detected compounds that may act as AHLs in the insect vector (psyllids) that are healthy or infected with CLas, but not in the citrus plants. This finding suggests that the insect is the AHL source. The fact that CLas forms a biofilm on the surface of the insect gut indicates the presence of a cell-cell communication system. Here the system is solo LuxR. Moreover, we have confirmed the activity of CLas-LuxR by its expression in \nE. coli\n and detection of LuxR-AHL complex. In order to block the vector transmission of CLas, we produced plants that express LuxR. Insects will acquire CLas and luxR. LuxR will compete with the bacteria for binding to AHL and consequently, CLas will not be able to colonize the insect or form biofilm and fails in the transmission. We aim to provide an environmental friendly solution for the most destructive disease in citrus (Huanglongbing) by producing specific LuxR in citrus to interfere with the vector transmission. As an alternative, we also aim to use synthetic molecules that mimic the specific AHL as an application to disrupt CLas transmission from plant to plant by its vector. More AHL in the insect may confuse the bacteria and induce a strong sticky biofilm that hardly releases cells to plants during insect feeding. Accordingly, the transmission from plant to plant will be diminished or blocked.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/1053363x", "frozenauthors": [ { "first_name": "N.", "middle_name": "", "last_name": "Killiny", "name_suffix": "", "institution": "Citrus research and Education Center, IFAS, University of Florida, Florida, USA", "department": "None" }, { "first_name": "S.", "middle_name": "", "last_name": "Hajeri", "name_suffix": "", "institution": "Citrus research and Education Center, IFAS, University of Florida, Florida, USA", "department": "None" }, { "first_name": "S.", "middle_name": "", "last_name": "Gowda", "name_suffix": "", "institution": "Citrus research and Education Center, IFAS, University of Florida, Florida, USA", "department": "None" }, { "first_name": "M.", "middle_name": "J.", "last_name": "Davis", "name_suffix": "", "institution": "Citrus research and Education Center, IFAS, University of Florida, Florida, USA", "department": "None" } ], "date_submitted": "2014-11-25T21:36:58+01:00", "date_accepted": "2014-11-25T21:36:58+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41259/galley/30858/download/" } ] }, { "pk": 59101, "title": "DNA: Building Blocks of Nanotechnology", "subtitle": null, "abstract": "", "language": "en", "license": null, "keywords": [], "section": "Features", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/3jj458tz", "frozenauthors": [ { "first_name": "Alexander", "middle_name": "", "last_name": "Powers", "name_suffix": "", "institution": "University of California, Berkeley", "department": "" } ], "date_submitted": "2014-04-29T03:38:20+02:00", "date_accepted": "2014-04-29T03:38:20+02:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/our_bsj/article/59101/galley/45129/download/" } ] }, { "pk": 19644, "title": "Donoso, Isaac y Andrea Gallo, eds. Literatura hispanofilipina actual. Madrid: Verbum, 2011. Impreso. 177 pp.", "subtitle": null, "abstract": "Donoso, Isaac y Andrea Gallo, eds. \nLiteratura hispanofilipina actual\n. Madrid: Verbum, 2011. Impreso. 177 pp.", "language": "en", "license": { "name": "none", "short_name": "none", "text": "", "url": "https://escholarship.org/terms" }, "keywords": [], "section": "Book Reviews", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/7qz9s5c9", "frozenauthors": [ { "first_name": "Paula", "middle_name": "", "last_name": "Park", "name_suffix": "", "institution": "", "department": "None" } ], "date_submitted": "2014-11-05T02:13:29+01:00", "date_accepted": "2014-11-05T02:13:29+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/transmodernity/article/19644/galley/9731/download/" } ] }, { "pk": 41248, "title": "Early detection surveillance for Huanglongbing in a plantation; from theory to practice", "subtitle": null, "abstract": "The detection of a new HLB epidemic in a planting often occurs when the disease has already reached high incidence. This is problematic and once the epidemic has become established it is difficult to recover the economic productivity of the grove. However, if new epidemics can be detected early enough then more can be done to control the disease. Early detection requires that surveillance surveys be in place before the disease arrives; that is, a number of trees within a healthy grove should be inspected at regular intervals for symptoms of HLB. Exactly how many trees should be surveyed and how frequently this should be done is a non-trivial problem and one that has not previously been addressed in plant pathology. We present a theoretical method that relates the dynamics of an invading epidemic to the dynamics of a monitoring program. The method determines exactly how an early detection survey should be designed in order to achieve a high probability of detecting an epidemic whilst it is at an early stage. We compare the theoretical method to a complex simulation model which replicates the spatial and temporal dynamics of HLB in the field. By running the model thousands of times we can make probabilistic predictions on early detection survey design that can be directly compared with the theoretical method. We find striking similarities between the simple theoretical and more complicated simulation approach that enables us to make valuable new insights as well as deliver methods for transfer into practice.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/68g7k5sk", "frozenauthors": [ { "first_name": "S.", "middle_name": "", "last_name": "Parnell", "name_suffix": "", "institution": "Rothamsted Research, Harpenden, United Kingdom", "department": "None" }, { "first_name": "T.", "middle_name": "R.", "last_name": "Gottwald", "name_suffix": "", "institution": "USDA, ARS, U.S. Horticultural Research Laboratory, Fort Pierce, FL 34945, USA", "department": "None" }, { "first_name": "N.", "middle_name": "J.", "last_name": "Cunniffe", "name_suffix": "", "institution": "University of Cambridge, Department of Plant Sciences, Cambridge, United Kingdom", "department": "None" }, { "first_name": "F.", "middle_name": "", "last_name": "van den Bosch", "name_suffix": "", "institution": "Rothamsted Research, Harpenden, United Kingdom", "department": "None" } ], "date_submitted": "2014-11-25T20:11:47+01:00", "date_accepted": "2014-11-25T20:11:47+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41248/galley/30847/download/" } ] }, { "pk": 41334, "title": "Early root infection and damage in Huanglongbing disease development", "subtitle": null, "abstract": "Huanglongbing in grove trees is initially identified by foliar symptoms, most commonly blotchy mottle. Detection of \nCandidatus\n Liberibacter asiaticus (Las) in leaf tissue by qPCR early in disease development is usually limited to symptomatic leaves and proximal young leaves. Over multiple years, disease symptoms spread to the rest of the canopy. Although Las has been detected in root tissue, the decline of roots has been assumed to happen later in disease development when photosynthate production and transport have been significantly diminished in the tree canopy. Observations of initial spread of Las from the bud-inoculation site in the trunk of 1-yr-old potted trees have revealed that Las is frequently detectable in roots months before detection of Las in leaves and foliar symptom development. Even after symptom development Las is more evenly distributed in root tissue than in the canopy. Preliminary evidence suggests that Las is also more evenly distributed in roots of grove trees. Asymptomatic 9 year old grove trees with root Las infection had 26-41% lower root density than asymptomatic trees without detectable root Las. The loss of root density was independent of Las detection in leaves. Root loss precedes carbohydrate starvation as evidenced by root starch concentrations, suggesting the bacteria may play a more active role in root loss than phloem plugging. These results suggest that early invasion of roots by Las leads to root decline before the appearance of foliar symptoms and is likely the cause of larger than expected yield reduction on trees with limited foliar symptoms.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/9g12g03c", "frozenauthors": [ { "first_name": "E.", "middle_name": "G.", "last_name": "Johnson", "name_suffix": "", "institution": "UF-CREC, Lake Alfred, Florida, USA", "department": "None" }, { "first_name": "J.", "middle_name": "", "last_name": "Wu", "name_suffix": "", "institution": "UF-CREC, Lake Alfred, Florida, USA", "department": "None" }, { "first_name": "D.", "middle_name": "B.", "last_name": "Bright", "name_suffix": "", "institution": "UF-CREC, Lake Alfred, Florida, USA", "department": "None" }, { "first_name": "J.", "middle_name": "H.", "last_name": "Graham", "name_suffix": "", "institution": "UF-CREC, Lake Alfred, Florida, USA", "department": "None" } ], "date_submitted": "2014-12-19T01:05:30+01:00", "date_accepted": "2014-12-19T01:05:30+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41334/galley/30933/download/" } ] }, { "pk": 20974, "title": "Eco-Certification of Natural Rubber: Demand, Supply, and Potential Implications of Private Global Environmental Governance", "subtitle": null, "abstract": "In recent years, concern over the environmental impacts of natural rubber culti- vation has generated considerable interest in eco-certification, a form of private environ- mental regulation designed to encourage more sustainable land-use practices. This paper explores the emergence and potential sovereignty implications of this approach to envi- ronmental control with an emphasis on the natural rubber industry. I argue that although eco-certification is advocated as a form of networked governance representing a range of political interests, the way certification programs position themselves as transparent and accountable alternatives to state-based regulation potentially serves to delegitimize the role of the state in the arena of environmental regulation.", "language": "en", "license": { "name": "none", "short_name": "none", "text": "", "url": "https://escholarship.org/terms" }, "keywords": [], "section": "Article", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/02d3918r", "frozenauthors": [ { "first_name": "Sean", "middle_name": "", "last_name": "Kennedy", "name_suffix": "", "institution": "UCLA", "department": "None" } ], "date_submitted": "2014-11-24T00:57:00+01:00", "date_accepted": "2014-11-24T00:57:00+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/criticalplanning/article/20974/galley/10676/download/" } ] }, { "pk": 19633, "title": "Ecos de poetas hispánicos en los versos de José Rizal", "subtitle": null, "abstract": "Ecos de poetas hispánicos en los versos de José Rizal", "language": "en", "license": { "name": "none", "short_name": "none", "text": "", "url": "https://escholarship.org/terms" }, "keywords": [], "section": "Article", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/40j9h77j", "frozenauthors": [ { "first_name": "Brooke F.", "middle_name": "", "last_name": "Cadwallader Dóndiz y Clavería", "name_suffix": "", "institution": "", "department": "None" } ], "date_submitted": "2014-11-04T19:45:12+01:00", "date_accepted": "2014-11-04T19:45:12+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/transmodernity/article/19633/galley/9720/download/" } ] }, { "pk": 41246, "title": "Edge Effects and Huanglongbing", "subtitle": null, "abstract": "Huanglongbing (HLB), spread by a psyllid vector, is globally considered a major threat to commercial and sustainable citrus production. Better understanding of the vector-mediated patterns of HLB spread is essential to inform and maximize disease management. From previous studies, edge effects are a significant characteristic of the HLB pathosystem and have been observed predominately in larger plantings. In this study, we investigated 1) the impact of different edge classes and orientations, 2) the quantitative influence of distance from edges, and 3) the temporal dynamics of each edge effect. Spatial analyses of edge effects were conducted on two years of HLB incidence data from the Southern Gardens plantation in south Florida.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/5hf0d0s3", "frozenauthors": [ { "first_name": "W.", "middle_name": "", "last_name": "Luo", "name_suffix": "", "institution": "USDA, ARS, US Horticultural Research Laboratory, Fort Pierce, Florida, USA;\nCIPM, NC State University, Raleigh, North Carolina, USA", "department": "None" }, { "first_name": "D.", "middle_name": "J.", "last_name": "Anco", "name_suffix": "", "institution": "USDA, ARS, US Horticultural Research Laboratory, Fort Pierce, Florida, USA;\nCIPM, NC State University, Raleigh, North Carolina, USA", "department": "None" }, { "first_name": "T.", "middle_name": "R.", "last_name": "Gottwald", "name_suffix": "", "institution": "USDA, ARS, US Horticultural Research Laboratory, Fort Pierce, Florida, USA;", "department": "None" }, { "first_name": "M.", "middle_name": "S.", "last_name": "Irey", "name_suffix": "", "institution": "Southern Gardens Citrus, US Sugar Corp., Clewiston, Florida, USA", "department": "None" } ], "date_submitted": "2014-11-25T19:48:40+01:00", "date_accepted": "2014-11-25T19:48:40+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41246/galley/30845/download/" } ] }, { "pk": 56464, "title": "Editorial", "subtitle": null, "abstract": "[no abstract]", "language": "en", "license": null, "keywords": [], "section": "Editorial", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/0r14j843", "frozenauthors": [ { "first_name": "Nana", "middle_name": "", "last_name": "Osei-Opare", "name_suffix": "", "institution": "UCLA", "department": "" }, { "first_name": "Jeremy", "middle_name": "Jacob", "last_name": "Peretz", "name_suffix": "", "institution": "UCLA", "department": "" } ], "date_submitted": "2014-12-14T04:32:30+01:00", "date_accepted": "2014-12-14T04:32:30+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/ufahamu/article/56464/galley/42872/download/" } ] }, { "pk": 63211, "title": "Editors' Introduction", "subtitle": null, "abstract": "Introduction to Volume 4, Issue 2.", "language": "en", "license": null, "keywords": [ { "word": "Education" } ], "section": "Editors' Introduction", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/0g93m2qd", "frozenauthors": [ { "first_name": "BRE", "middle_name": "", "last_name": "Editors", "name_suffix": "", "institution": "University of California, Berkeley", "department": "" } ], "date_submitted": "2014-02-28T01:35:19+01:00", "date_accepted": "2014-02-28T01:35:19+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/bre/article/63211/galley/48785/download/" } ] }, { "pk": 63752, "title": "Editor's Note", "subtitle": null, "abstract": "Journal of Critical Mixed Race Studies \n(JCMRS) is a new scholarly outlet that seeks to bring together innovative work on the topic of mixed race in the United States and abroad.", "language": "en", "license": { "name": "", "short_name": "", "text": null, "url": "" }, "keywords": [], "section": "Front Matter", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/5sg4b35k", "frozenauthors": [ { "first_name": "G.", "middle_name": "Reginald", "last_name": "Daniel", "name_suffix": "", "institution": "University of California, Santa Barbara", "department": "" } ], "date_submitted": "2014-01-27T02:35:35+01:00", "date_accepted": "2014-01-27T02:35:35+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/jcmrs/article/63752/galley/48956/download/" } ] }, { "pk": 6044, "title": "Education & Incarceration: How Their Intersection Affects a Latino/a Household", "subtitle": null, "abstract": "Education & Incarceration: How Their Intersection Affects a Latino/a Household", "language": "en", "license": { "name": "All rights reserved", "short_name": "Copyright", "text": "© the author(s). All rights reserved.", "url": "https://creativecommons.org/licenses/authors" }, "keywords": [], "section": "Articles", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/6f79486k", "frozenauthors": [ { "first_name": "Wendy", "middle_name": "", "last_name": "Hernandez", "name_suffix": "", "institution": "", "department": "None" } ], "date_submitted": "2014-11-23T06:33:02+01:00", "date_accepted": "2014-11-23T06:33:02+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "", "path": "https://journalpub.escholarship.org/our_buj/article/6044/galley/3682/download/" } ] }, { "pk": 41318, "title": "Effect of beneficial bacterial isolates from citrus roots in Florida on citrus Huanglongbing disease development", "subtitle": null, "abstract": "Huanglongbing (HLB) is the most devastating disease of citrus in Florida. HLB is caused by the phloem-inhabiting bacterium ‘\nCandidatus \nLiberibacter asiaticus’ (Las), which is transmitted by psyllid vector \nDiaphorina citri\n. The current management strategies of HLB are to control psyllids and eradicate infected plants. However, these management practices have not been able to stop the spreading of HLB (Duan et al. 2009). Alternative approaches are needed to control HLB. In previous studies we isolated multiple bacterial strains from roots of healthy citrus plants in HLB infected groves in Florida, which have the potential to enhance plant growth and suppress diseases (Trivedi et al. 2011). Recently, early infection of roots by Las leading to root decline was suggested to be important in HLB disease development (Johnson et al. 2012). We hypothesize that introduction of beneficial bacteria to roots of citrus plants could decrease root damage by promoting root growth and reducing Las infection and thus improve HLB management. To test this hypothesis, six beneficial bacteria were assessed for their plant growth-promotion ability; and three were found to be able to promote growth of both grapefruit and \nArabidopsis\n (Col-0 ecotype) in greenhouse experiments, with increases in root length and weight, compared to mock treated plants. Thus, the three isolates were selected to evaluate the effect on Las infection in greenhouse assays. Details of the beneficial bacterial isolates, plant growth-promotion activity, and effect on Las infection will be discussed.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/8f6364rt", "frozenauthors": [ { "first_name": "J.", "middle_name": "", "last_name": "Li", "name_suffix": "", "institution": "Citrus Research and Education Center, Department of Microbiology and Cell Science, University of Florida, Lake Alfred, FL, 33850 USA", "department": "None" }, { "first_name": "P.", "middle_name": "", "last_name": "Trivedi", "name_suffix": "", "institution": "Citrus Research and Education Center, Department of Microbiology and Cell Science, University of Florida, Lake Alfred, FL, 33850 USA", "department": "None" }, { "first_name": "N.", "middle_name": "", "last_name": "Wang", "name_suffix": "", "institution": "Citrus Research and Education Center, Department of Microbiology and Cell Science, University of Florida, Lake Alfred, FL, 33850 USA", "department": "None" } ], "date_submitted": "2014-12-17T23:48:14+01:00", "date_accepted": "2014-12-17T23:48:14+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41318/galley/30917/download/" } ] }, { "pk": 41324, "title": "Effect of Enhanced Zinc Nutrition on Mitigation of Huanglongbing (HLB)-affected Citrus", "subtitle": null, "abstract": "The growth decline of huanglongbing (HLB)-affected citrus trees is considered to be associated with nutritional disorder, as typical symptoms of HLB such as stunted tree growth, chlorosis or blotchy mottle of leaves, resembles zinc (Zn), iron (Fe) and manganese (Mn) deficiencies, while lower Zn concentration has been consistently reported in the HLB affected compared to healthy plants. Hydroponic culture studies were conducted to evaluate the effects of enhanced Zn nutrition on the mitigation of HLB-affected grapefruit seedlings. Modified Hoagland nutrient solutions were used with three Zn2+ levels: 0, 1.0, and 1.5 times that of standard strength. Both HLB-affected and healthy grapefruit seedlings were subjected to the treatments for 49 days. During the growth period, photosynthesis of plant leaves was measured, and at day 49 of the culture, leaf tissues and cells were examined for structural changes using light and scanning electron microscopy. Enhanced Zn nutrition generally improved the growth of HLB plants with less symptom severity. Photosynthesis, in terms of leaf electron transfer rate and photochemical quantum yield, was enhanced. The wax layer and cuticle increased, and the epidermis cells became better organized, with a higher number of normal stomatal openings, compared to the control. In addition, enhanced Zn nutrition resulted in more developed xylem and phloem transport systems, resulting in reduced starch grains and polyphenol substances in the leaf cells. These results indicate that\n \nenhanced Zn nutrition can improve the structure of photosynthetic, transfusion and protective tissue systems, and thus promote photosynthesis, transport of photosynthates, and other related metabolism of HLB-infected citrus.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/1pv647wv", "frozenauthors": [ { "first_name": "S.", "middle_name": "L.", "last_name": "Li", "name_suffix": "", "institution": "University of Florida, IFAS, Indian River REC, Fort Pierce, USA", "department": "None" }, { "first_name": "Z.", "middle_name": "G.", "last_name": "Li", "name_suffix": "", "institution": "University of Florida, IFAS, Indian River REC, Fort Pierce, USA", "department": "None" }, { "first_name": "Z.", "middle_name": "L.", "last_name": "He", "name_suffix": "", "institution": "University of Florida, IFAS, Indian River REC, Fort Pierce, USA", "department": "None" } ], "date_submitted": "2014-12-18T00:11:16+01:00", "date_accepted": "2014-12-18T00:11:16+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41324/galley/30923/download/" } ] }, { "pk": 41277, "title": "Effect of Mineral Oil on Host Selection and Control of Diaphorina citri Kuwayama (Hemiptera: Psillidae) on Citrus", "subtitle": null, "abstract": "This research was carried out to study the influence of mineral oil on landing and permanence; oviposition; and mortality of \nDiaphorina citri\n Kuwayama (Hemiptera: Psyllidae) on citrus plants. For all experiments, mineral oil (Argenfrut®) was sprayed on sweet orange plants at 1% concentration. Landing-permanence and oviposition were assessed using choice and non-choice tests. For the first parameter, 50 adult psyllids were released in the center of the screen house (5mx2.5mx2m) (n = 10) and the number of psyllids/plant at different time intervals were counted. For the oviposition trial, which was conducted under laboratory conditions, 20 psyllids were confined in a cage to oviposit (n = 10) and after three days the number of eggs/plant were counted. The effect of mineral oil on psyllid mortality was assessed by confining 10 adult psyllids per plant (n=4) with fully expanded mature leaves after spray. Assessment was conducted 7 days after confining the insects, by determining the number of live and dead psyllids. The results of this research indicate that mineral oil has repellent effect on adults of \nD. citri\n, which prefer oil-free plants to land, remain and oviposit. Moreover, mineral oil was effective on \nD. citri \ncontrol (mortality≥80%).", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/9dc2215g", "frozenauthors": [ { "first_name": "M.", "middle_name": "P.", "last_name": "Miranda", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" }, { "first_name": "M.", "middle_name": "L.", "last_name": "Micelli", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" }, { "first_name": "M.", "middle_name": "R.", "last_name": "Felippe", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" }, { "first_name": "R.", "middle_name": "E.", "last_name": "Caldeira", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" }, { "first_name": "P.", "middle_name": "T.", "last_name": "Yamamoto", "name_suffix": "", "institution": "ESALQ/Universidade de São Paulo, Piracicaba, Brazil", "department": "None" } ], "date_submitted": "2014-12-16T23:28:30+01:00", "date_accepted": "2014-12-16T23:28:30+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41277/galley/30876/download/" } ] }, { "pk": 41236, "title": "Effect of Temperature on Lighted Sticky Traps (TransTrap®) used to Detect Asian Citrus Psyllids in Shipping Containers", "subtitle": null, "abstract": "The Asian citrus psyllid (ACP) is an insect native to tropical and subtropical regions in Asia, which has spread into most citrus producing regions around the world. The main concern with ACP is the spread of Huanglongbing (HLB), a disease vectored by the psyllid. The volume of citrus shipments from Mexico into the U.S. prompted questions about the risk of moving ACP and HLB on this pathway. Our goal was to determine temperatures at which ACP would be active and thus fly to lighted sticky traps inside a transport trailer.\n \nOur results found that temperature significantly affected the number of adults captured. No psyllids were recovered on the traps at 12˚C (53˚F), which is the average temperature of citrus shipments crossing the border. This is compare with an average capture of 43, 47, and 42% of the released adults at 24, 28, and 32°C (75, 82, and 90°F), respectively. Only 1%, 2% and 18% were captured at 18, 20 and 22°C (64, 68, and 72˚F), respectively. Given that the average temperature of limes arriving at the border is 12˚C, it is unlikely that ACP adults would fly to a lighted sticky trap placed inside a refrigerated trailer. In addition, the majority of the packing houses in Mexico place the fruit into coolers prior to loading. We believe a lighted sticky trap would not be effective in detecting ACP within refrigerated citrus shipments for the period of time from loading at the packing house to trap recovery at the border crossing.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/43n666nv", "frozenauthors": [ { "first_name": "David", "middle_name": "", "last_name": "Bartels", "name_suffix": "", "institution": "USDA APHIS PPQ CPHST Mission Lab, Edinburg, TX", "department": "None" }, { "first_name": "Jason", "middle_name": "", "last_name": "Carlson", "name_suffix": "", "institution": "USDA APHIS PPQ CPHST Mission Lab, Edinburg, TX", "department": "None" }, { "first_name": "Matt", "middle_name": "", "last_name": "Ciomperlik", "name_suffix": "", "institution": "USDA APHIS PPQ CPHST Mission Lab, Edinburg, TX", "department": "None" } ], "date_submitted": "2014-11-20T01:01:39+01:00", "date_accepted": "2014-11-20T01:01:39+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41236/galley/30835/download/" } ] }, { "pk": 41237, "title": "Effect of time and storage methods on the detection of Candidatus Liberibacter asiaticus in Diaphorina citri by qPCR", "subtitle": null, "abstract": "The assessment of bacterialiferous Asian citrus psyllid (ACP) frequency is important for (i) studies of bacteria acquisition and inoculation by ACP, (ii) disease detection in disease free areas but with ACP presence, (iii) efficiency evaluation of inoculum reduction strategies, (iv) evaluation of frequency of \nCandidatus \nLiberibacter asiaticus (Las)-positive ACP and the abundance of inoculum sources or putative new HLB infections relationships. Depending on the conditions and time of storage of collected psyllids, Las DNA in ACP could degrade and Las-false negative results might occur. Thus, this study was conducted to evaluate the detection of Las in ACP adults submitted to different storage methods and time of storage by real-time PCR (qPCR). Two 2x3x7 factorial experiments were conducted. Factors were ‘Ethanol’ (with or without 70% ethanol), ‘Temperature’ (-20°C, 4°C and 26°C) and ‘Time’ (0, 3, 7, 14, 21, 28 and 35 days). For each treatment, 20 samples with 3 ACP adults from nymphs reared on Las infected trees were tested for Las presence by qPCR. No significant differences in percentages of psyllids samples positive for Las were observed among the storage methods up to 35 days, except a slight trend of decline in Las detection in samples storage without ethanol at 26°C after 14 days of storage.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/86v5p9sb", "frozenauthors": [ { "first_name": "I.", "middle_name": "", "last_name": "Sala", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" }, { "first_name": "E.", "middle_name": "C.", "last_name": "Martins", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" }, { "first_name": "D.", "middle_name": "A.B.", "last_name": "Coletti", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" }, { "first_name": "L.", "middle_name": "H.", "last_name": "Montesino", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" }, { "first_name": "R.", "middle_name": "B.", "last_name": "Bassanezi", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" }, { "first_name": "N.", "middle_name": "A.", "last_name": "Wulff", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" }, { "first_name": "D.", "middle_name": "C.", "last_name": "Teixeira", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" } ], "date_submitted": "2014-11-20T01:03:49+01:00", "date_accepted": "2014-11-20T01:03:49+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41237/galley/30836/download/" } ] }, { "pk": 41284, "title": "Effects of Tagetes coronopifolia and T. lemmonii (Asteraceae) essential oils in nymphs of Diaphorina citri (Hemiptera: Psyllidae)", "subtitle": null, "abstract": "Diaphorina citri Kuwayama (Hemiptera: Psyllidae) is performed mainly by the use of agrochemicals. Often, indiscriminate use of insecticides has resulted in the elimination of natural enemies and in the development of insecticide resistance in the target pest and in no target insects. This situation has motivated the generation and implementation of alternative strategies, such as the use of insecticidal plants. This study was carried out to evaluate the toxic effect of \nTagetes coronopifolia\n Willd.\n \nand \nT. lemmonii \nA. Gray (Asteraceae) essential oils in \nD. citri\n third\n \ninstar nymphs. Effect was evaluated by orange disc immersion method. Mortality was recorded 24 hours after applying the oils; the log dose response line Probit and the LC50 values were determined. \nT. coronopifolia \nand \nT. lemmonni \noils were toxic to \nD. citri \nnymphs and the effect was positively related to the concentration. Highest nymph mortality (≥ 98%) with both oils was registered in concentrations of 10 mg mL-1. The LC50 estimated for \nT. lemmonii \nand \nT. coronopifolia \noils was 0.034 and 0.094 mg mL-1, respectively.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/2z22z5n9", "frozenauthors": [ { "first_name": "E.", "middle_name": "E.", "last_name": "Mendoza-García", "name_suffix": "", "institution": "Colegio de Postgraduados, Campus Montecillo, Entomología. Montecillo, Estado de México, 56230", "department": "None" }, { "first_name": "L.", "middle_name": "D.", "last_name": "Ortega-Arenas", "name_suffix": "", "institution": "Colegio de Postgraduados, Campus Montecillo, Entomología. Montecillo, Estado de México, 56230", "department": "None" }, { "first_name": "M.", "middle_name": "A.", "last_name": "Serrato-Cruz", "name_suffix": "", "institution": "Universidad Autónoma Chapingo-Agroecología, Chapingo, Estado de México, 56230", "department": "None" }, { "first_name": "J.", "middle_name": "A.", "last_name": "Villanueva-Jiménez", "name_suffix": "", "institution": "Colegio de Postgraduados, Campus Montecillo, Entomología. Montecillo, Estado de México, 56230", "department": "None" }, { "first_name": "J.", "middle_name": "I.", "last_name": "López-Arroyo", "name_suffix": "", "institution": "INIFAP, Centro de Investigación Regional del Noreste. Río Bravo, Tam., México, 88900", "department": "None" }, { "first_name": "R.", "middle_name": "", "last_name": "Pérez-Pacheco", "name_suffix": "", "institution": "CIIDIR-OAXACA-IPN. Xoxocotlán, Oaxaca, México, 71230. mendoza.edgar@colpos.mx", "department": "None" } ], "date_submitted": "2014-12-17T00:43:29+01:00", "date_accepted": "2014-12-17T00:43:29+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41284/galley/30883/download/" } ] }, { "pk": 41234, "title": "Efficiency of different set of primers in PCR detection of 'Candidatus Liberibacter asiaticus’", "subtitle": null, "abstract": "Huanglongbing (HLB), caused by the bacteria ‘\nCandidatus \nLiberibacter spp’, is one of the most destructive diseases for citrus production around the world. Early diagnosis of diseased citrus trees is of utmost importance for the control of HLB. Molecular techniques, such as PCR, offer quick and specific detection and identification of ‘\nCa\n. Liberibacter spp.’. Furthermore, different sets of primers have been used for detection of ‘\nCa\n. Liberibacter asiaticus’, the main agent of HLB. However, neither of the described sets of primers may detect all cases of HLB. Thus, conventional PCR using three common sets of primers, A2/J5, OI1/OI2c, and Lp1c/HP1, which amplify fragments of 703 pb, 1200 pb, and 2400 pb, respectively, were examined for HLB diagnosis. A total of 969 samples from different citrus cultivars, tree ages and regions of the State of Paraná, Brazil, were included in this study. The total number of samples tested positive for HLB by any set of primers were 598, representing 61.7% of the samples examined. Among these positive samples, 96.7% were identified with the primers A2/J5, 86.6% with OI2c/OI1, and 81.4% with HP1/Lp1c. When combined, 99.8% of the samples were HLB positive based on the sets of primers A2/J5 and OI2c/OI1. Based on the results obtained, the set of primers A2/J5 showed the highest efficiency in the detection of HLB for the bacterium that occurs in the State of Parana, Brazil.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/4vw2q5tb", "frozenauthors": [ { "first_name": "L.", "middle_name": "", "last_name": "Meneguim", "name_suffix": "", "institution": "IAPAR, Área de Proteção de Plantas, Londrina, Paraná, Brazil", "department": "None" }, { "first_name": "A.", "middle_name": "L.", "last_name": "Naldi", "name_suffix": "", "institution": "UNIFIL, Centro Universitário Filadelfia, Londrina, Paraná, Brazil", "department": "None" }, { "first_name": "C.", "middle_name": "D.", "last_name": "Poças", "name_suffix": "", "institution": "", "department": "None" }, { "first_name": "R.", "middle_name": "P.", "last_name": "Leite Júnior", "name_suffix": "", "institution": "IAPAR, Área de Proteção de Plantas, Londrina, Paraná, Brazil", "department": "None" } ], "date_submitted": "2014-11-20T00:55:38+01:00", "date_accepted": "2014-11-20T00:55:38+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41234/galley/30833/download/" } ] }, { "pk": 19629, "title": "El privilegio de subvertir: la literatura hispanofilipina", "subtitle": null, "abstract": "El privilegio de subvertir: la literatura hispanofilipina", "language": "en", "license": { "name": "none", "short_name": "none", "text": "", "url": "https://escholarship.org/terms" }, "keywords": [], "section": "Article", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/7f89w1jn", "frozenauthors": [ { "first_name": "Beatriz", "middle_name": "", "last_name": "Álvarez Tardío", "name_suffix": "", "institution": "", "department": "None" } ], "date_submitted": "2014-11-04T19:31:58+01:00", "date_accepted": "2014-11-04T19:31:58+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/transmodernity/article/19629/galley/9716/download/" } ] }, { "pk": 19638, "title": "En busca de un país: poesía filipina en inglés, desde 1905 hasta la actualidad", "subtitle": null, "abstract": "En busca de un país: poesía filipina en inglés, desde 1905 hasta la actualidad", "language": "en", "license": { "name": "none", "short_name": "none", "text": "", "url": "https://escholarship.org/terms" }, "keywords": [], "section": "Article", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/8rn9v7bb", "frozenauthors": [ { "first_name": "Gémino", "middle_name": "H.", "last_name": "Abad", "name_suffix": "", "institution": "", "department": "None" } ], "date_submitted": "2014-11-04T19:54:01+01:00", "date_accepted": "2014-11-04T19:54:01+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/transmodernity/article/19638/galley/9725/download/" } ] }, { "pk": 60718, "title": "Enforcing Perpetual Conservation Easements Against Third-Party Violators", "subtitle": null, "abstract": "Among the most daunting challenges the holder of a perpetual conservation easement faces is the enforcement of the easements it holds, for all time, and against all violators. National organizations estimate that at least forty million acres of land in the United States are protected with perpetual conservation easements. Each of these conservation easements is held by an entity, either a government agency or a tax-exempt, non-profit land trust, charged with the responsibility of enforcing easement violations against any and all violators. Holders must contend with violations caused by landowners and third parties. In the latter instance, someone who is not the owner of the easement-protected property enters the land by trespass without the knowledge or permission of the landowner or the easement holder, and violates the conservation easement. A Land Trust Alliance (Alliance) survey, specifically designed to gather information on conservation easement violations, reveals that behind successor-generation landowners, \nthird parties are the most frequent class of easement violators\n. The findings of this survey track those of an earlier Alliance survey and are consistent with violation reporting in the most recent Alliance census. Further, anecdotal reporting of conservation easement violations indicates that many violations are caused by third parties—possibly as much as forty percent. \nViolations caused by landowners whose lands are protected with conservation easements present fairly linear practical and legal avenues for resolution. The easement holder has an established means of reaching the landowner through the conservation easement document. When a third party causes a violation, the legal and practical avenues are less clear. Part II of this Article explores the legal and practical avenues available for pursuing third-party violators in the context of holders’ responsibilities regarding the applicable law of perpetual conservation easements. Part III identifies the tools available for conservation easement drafting, stewardship, management, and enforcement of third-party violations. Part IV distills lessons learned from litigated and non-litigated cases of third-party violations. The Article concludes by offering practical guidance to easement holders anticipating or addressing third-party violations.", "language": "en", "license": { "name": "", "short_name": "", "text": null, "url": "" }, "keywords": [ { "word": "Conservation Easements, third-party violators, environmental law, conservation, environmental protection, environment, perpetual conservation easement" } ], "section": "Articles", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/75z1t5kp", "frozenauthors": [ { "first_name": "Jessica", "middle_name": "E.", "last_name": "Jay", "name_suffix": "", "institution": "", "department": "" } ], "date_submitted": "2014-01-04T17:24:55+01:00", "date_accepted": "2014-01-04T17:24:55+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/uclalaw_jelp/article/60718/galley/46682/download/" } ] }, { "pk": 41346, "title": "Engineering Resistance Against Citrus Disease Using Candidate Genes", "subtitle": null, "abstract": "Citrus canker is a devastating disease caused by \nXanthomonas axonopodis \npv\n. citri\n (\nXac\n). The \nNPR1\n gene plays a pivotal role in systemic acquired resistance (SAR) in Arabidopsis. We report the isolation and characterization of an \nNPR1\n homolog from citrus, namely \nCitrus NPR1 homolog 1 \n(\nCtNH1\n). When over-expressed in citrus, \nCtNH1\n confers resistance to \nXac \nand leads to constitutive expression of the pathogenesis-related (\nPR\n) gene \nchitinase 1\n (\nChi1\n), suggesting that \nCtNH1\n is orthologous to \nNPR1\n. In addition, we recently identified two closely-related citrus genes, named \nXbct31\n and \nXbct32\n. Database searching and sequence analyses reveals that other plant species, including rice, Arabidopsis, tomato, and \nNicotiana benthamiana\n, contain homologs of these two citrus genes and they share high levels of sequence identity at the amino acid level. When overexpressed in \nNicotiana benthamiana\n via Agrobacterium infiltration-mediated transient expression, the citrus genes as well as their closely-related homologs from rice and Arabidopsis all trigger (HR)-like cell death hypersensitive response. Since HR is often associated with resistance (\nR\n) gene-mediated immunity, our data suggests \nXbct3s\n represent a family of evolutionarily conserved defense regulators and could be used to heighten defense against citrus diseases including greening and canker.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/2p34j1fm", "frozenauthors": [ { "first_name": "Xiuhua", "middle_name": "", "last_name": "Chen", "name_suffix": "", "institution": "Department of Plant Pathology, University of Florida, Gainesville, USA", "department": "None" }, { "first_name": "Jinyoung", "middle_name": "Y.", "last_name": "Barnaby", "name_suffix": "", "institution": "Department of Biology, Duke University, Durham, USA", "department": "None" }, { "first_name": "Xiaoen", "middle_name": "", "last_name": "Huang", "name_suffix": "", "institution": "Department of Plant Pathology, University of Florida, Gainesville, USA", "department": "None" }, { "first_name": "Aswathy", "middle_name": "", "last_name": "Sreedharan", "name_suffix": "", "institution": "Citrus Research and Education Center, University of Florida, Lake Alfred, USA", "department": "None" }, { "first_name": "Vladimir", "middle_name": "", "last_name": "Orbović", "name_suffix": "", "institution": "Citrus Research and Education Center, University of Florida, Lake Alfred, USA", "department": "None" }, { "first_name": "Jude", "middle_name": "W.", "last_name": "Grosser", "name_suffix": "", "institution": "Citrus Research and Education Center, University of Florida, Lake Alfred, USA", "department": "None" }, { "first_name": "Nian", "middle_name": "", "last_name": "Wang", "name_suffix": "", "institution": "Citrus Research and Education Center, University of Florida, Lake Alfred, USA", "department": "None" }, { "first_name": "Xinnian", "middle_name": "", "last_name": "Dong", "name_suffix": "", "institution": "Department of Biology, Duke University, Durham, USA", "department": "None" }, { "first_name": "Wen-Yuan", "middle_name": "", "last_name": "Song", "name_suffix": "", "institution": "Department of Plant Pathology, University of Florida, Gainesville, USA", "department": "None" } ], "date_submitted": "2014-12-19T01:48:08+01:00", "date_accepted": "2014-12-19T01:48:08+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41346/galley/30945/download/" } ] }, { "pk": 6023, "title": "Enhancing Memory for Therapy in Depression: A Text Messaging Intervention", "subtitle": null, "abstract": "Enhancing Memory for Therapy in Depression: A Text Messaging Intervention", "language": "en", "license": { "name": "All rights reserved", "short_name": "Copyright", "text": "© the author(s). All rights reserved.", "url": "https://creativecommons.org/licenses/authors" }, "keywords": [], "section": "Articles", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/95q0g156", "frozenauthors": [ { "first_name": "Anita", "middle_name": "", "last_name": "Satish", "name_suffix": "", "institution": "", "department": "None" } ], "date_submitted": "2014-11-23T06:03:43+01:00", "date_accepted": "2014-11-23T06:03:43+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "", "path": "https://journalpub.escholarship.org/our_buj/article/6023/galley/3661/download/" } ] }, { "pk": 19626, "title": "Ensayo historiográfico de las letras en Filipinas", "subtitle": null, "abstract": "Ensayo historiográfico de las letras en Filipinas", "language": "en", "license": { "name": "none", "short_name": "none", "text": "", "url": "https://escholarship.org/terms" }, "keywords": [], "section": "Article", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/9sc7w3wm", "frozenauthors": [ { "first_name": "Isaac", "middle_name": "", "last_name": "Donoso", "name_suffix": "", "institution": "", "department": "None" } ], "date_submitted": "2014-11-04T19:27:48+01:00", "date_accepted": "2014-11-04T19:27:48+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/transmodernity/article/19626/galley/9713/download/" } ] }, { "pk": 41297, "title": "Entomophagous insects associated to Diaphorina citri (Hemiptera: Psyllidae) in citrus orchards with different weed management systems in Papantla, Veracruz, Mexico", "subtitle": null, "abstract": "Huanglongbing (HLB), one of the most destructive diseases of citrus worldwide, is threatening the survival of the citrus industry in Mexico. \nDiaphorina citri \nis the primary vector of HLB; thus, control of the vector it’s vital for disease management. This study was carried out to evaluate the influence of different management systems on the population psyllid density and entomophagous insects associated in orange orchards (\nCitrus sinensis \ncv. Valencia) in Papantla, Veracruz, Mexico. Five orchards with different management strategies were selected: 1) Manual and mechanical weed control and insecticide application, 2) Manual and mechanical weed control, with insecticide application, and high planting density, 3) Manual and mechanical weed control, without insecticide, 4) Constant herbicide application, without insecticide, and 5) Manual weed control, mechanical soil removal, herbicide application, without insecticide. Each orchard was sampled, monthly. Psyllids adults were captured on yellow sticky traps. Eggs, nymphs and adults of \nD. citri\n, and natural enemies were collected on flush shoots. Results show that the diversity of weeds varied according to the handling and sampling date and was higher in orchards and dates where herbicide use was reduced or null. \nCycloneda sanguinea, Azya \nsp., \nScymnus \nsp., \nCurinus \nsp., and \nBrachiacantha \nsp. were the predators collected. There was synchrony among populations of \nD. citri, \npredators and abundance of flush shoots. The presence of the parasitoid \nTamarixia radiata \nwas minimal as a result of the low \nD. citri \nnymphs density. The results suggest that weeds diversity guarantee the survival of predators, because they supply alternative food resources.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/9m28x9d7", "frozenauthors": [ { "first_name": "L.", "middle_name": "D.", "last_name": "Ortega-Arenas", "name_suffix": "", "institution": "Colegio de Postgraduados, Campus Montecillo, Entomología. 56230. Montecillo, Estado de México", "department": "None" }, { "first_name": "R.", "middle_name": "", "last_name": "López-López", "name_suffix": "", "institution": "Universidad Autónoma Chapingo- Agroecología, Chapingo, Estado de México, C. P. 56230. México", "department": "None" }, { "first_name": "J.", "middle_name": "R.", "last_name": "Lomelí-Flores", "name_suffix": "", "institution": "Colegio de Postgraduados, Campus Montecillo, Entomología. 56230. Montecillo, Estado de México", "department": "None" }, { "first_name": "E.", "middle_name": "", "last_name": "Cedillo-Portugal", "name_suffix": "", "institution": "Universidad Autónoma Chapingo- Agroecología, Chapingo, Estado de México, C. P. 56230. México", "department": "None" }, { "first_name": "L.", "middle_name": "", "last_name": "Gómez-Tovar", "name_suffix": "", "institution": "Universidad Autónoma Chapingo- Agroecología, Chapingo, Estado de México, C. P. 56230. México", "department": "None" }, { "first_name": "J.", "middle_name": "", "last_name": "Salazar-Cruz", "name_suffix": "", "institution": "Universidad Autónoma Chapingo- Agroecología, Chapingo, Estado de México, C. P. 56230. México", "department": "None" }, { "first_name": "A.", "middle_name": "", "last_name": "Villegas-Monter", "name_suffix": "", "institution": "Colegio de Postgraduados, Campus Montecillo, Entomología. 56230. Montecillo, Estado de México", "department": "None" } ], "date_submitted": "2014-12-17T08:50:20+01:00", "date_accepted": "2014-12-17T08:50:20+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41297/galley/30896/download/" } ] }, { "pk": 60724, "title": "Environmental Federalism when Numbers Matter More than Size", "subtitle": null, "abstract": "Two elements of the Clean Air Act are viewed as essential to its many successes: the health-based national ambient air quality standards (NAAQS), which restrict emissions of six widely released air pollutants, and the statute’s hybrid form of cooperative federal-state regulation. This Article will show that these programs are far less important to the operation of the statute than conventional wisdom would have you believe. An amalgam of parallel programs and external constraints, both political and practical, have marginalized the NAAQS framework and limited state action, such that in practice the law is more federal than it is cooperative.\n \nTheories of environmental federalism have reinforced these misperceptions by focusing unduly on regulatory pathologies associated with large corporations (e.g., interstate regulatory races to the bottom, agency capture). While industrial sources are undoubtedly important, air pollution in the United States is largely a collective problem for which the number of sources matters more than their size. Environmental Protection Agency data show that urban density is the principal reason that almost 50 percent of Americans live in areas that fail to meet one or more NAAQS. The prevailing focus on emissions from large industrial facilities is misleading because it obscures many of the most important sources of air pollution and, perhaps more importantly, because it causes academics and policymakers to make assumptions about the political economy of clean air regulation that do not apply to the small, diffuse sources that account for most air pollution nationally.\n \nRecognizing the structural limits and inconsistencies of clean air policy opens up significant opportunities for reform. First, EPA could be given the authority to set NAAQS compliance deadlines and to condition approval of state plans on adoption of specific programs. These reforms would refocus the planning process from meeting narrow bureaucratic ends to developing innovative programs and setting transparent compliance schedules. Second, federal regulation of major industrial sources skews regulatory priorities and unnecessarily limits state authority to select policies and allocate emissions across sources. I will argue that the two programs could be eliminated as part of compromise legislation to achieve broader reforms on issues such as climate change.", "language": "en", "license": { "name": "", "short_name": "", "text": null, "url": "" }, "keywords": [ { "word": "Clean Air Act, CO2, Climate Change, NAAQS, Global Warming, GHG, Environmental Federalism" } ], "section": "Articles", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/37v357zq", "frozenauthors": [ { "first_name": "David", "middle_name": "E.", "last_name": "Adelman", "name_suffix": "", "institution": "Harry Reasoner Regents Chair in Law, The University of Texas at Austin School of Law", "department": "" } ], "date_submitted": "2014-05-14T19:20:30+02:00", "date_accepted": "2014-05-14T19:20:30+02:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/uclalaw_jelp/article/60724/galley/46688/download/" } ] }, { "pk": 60717, "title": "Environmental Law, \nClapper v. Amnesty International USA\n, and the Vagaries of Injury-in-Fact: \"Certainly Impending\" Harm, \"Reasonable Concern,\" and \"Geographic Nexus\"", "subtitle": null, "abstract": "Clapper v. Amnesty International USA\n further muddies the already confusing doctrine of injury-in-fact in the law of Article III standing. This article examines \nClapper\n and proposes clarification of three problematic aspects of injury-in-fact, which arise in environmental litigation: the concepts of “certainly impending harm;” “reasonable concern;” and “geographic nexus.” \nClapper’s\n broad language suggesting that imminent injury must meet a very strict, “certainly impending” standard should be viewed in light of the case law adjudicating probabilistic harms, which reveals that “certainly impending” does not even approach a preponderance standard. Rather, it encompasses a wide range of environmental and public health risks where the plaintiffs have established a nexus to the challenged action. \nClapper\n should be interpreted as denying standing because of the plaintiffs’ inability to establish a nexus to surveillance activities, akin to the geographic nexus required in environmental cases. \nClapper\n can also be distinguished because of its reliance on the uncertainty associated with subsequent, intervening actions required to consummate the alleged injury. \nClapper\n’s language conflating the “reasonable concern” doctrine from \nFriends of the Earth, Inc. v. Laidlaw Environmental Services (TOC), Inc.\n with the “certainly impending” test must be corrected, and “reasonable concern” should be presumed in future cases where the plaintiffs establish a geographic nexus to violations of environmental law. Finally, the test for geographic nexus in environmental cases should account for indirect and cumulative impacts, and should not depend on proof of nexus to precise acreages.", "language": "en", "license": { "name": "", "short_name": "", "text": null, "url": "" }, "keywords": [ { "word": "Clapper v. Amnesty International, Standing, Article III Standing, Environmental Law, Geographic Nexus, Reasonable Concern, Certainly Impending Harm, Laidlaw" } ], "section": "Articles", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/8jm8m58q", "frozenauthors": [ { "first_name": "Patrick", "middle_name": "", "last_name": "Gallagher", "name_suffix": "", "institution": "", "department": "" } ], "date_submitted": "2014-01-04T17:19:12+01:00", "date_accepted": "2014-01-04T17:19:12+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/uclalaw_jelp/article/60717/galley/46681/download/" } ] }, { "pk": 52630, "title": "Establishing Permanence: The California Statehood and Southern California Stadiums in the Early 1920s", "subtitle": null, "abstract": "", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "<p>Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use. No additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.</p>", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [ { "word": "History" }, { "word": "Stadiums" }, { "word": "california" }, { "word": "sports" }, { "word": "Statehood" } ], "section": "Articles", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/0cx22867", "frozenauthors": [ { "first_name": "Laura", "middle_name": "", "last_name": "Gomez", "name_suffix": "", "institution": "UC Merced", "department": "" } ], "date_submitted": "2014-05-15T20:48:55+02:00", "date_accepted": "2014-05-15T20:48:55+02:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/ssha_uhj/article/52630/galley/39686/download/" } ] }, { "pk": 41310, "title": "Estimating the Economic Impact of an Eventual Introduction of Huanglongbing (HLB) in the State of Bahia, Brazil", "subtitle": null, "abstract": "Bahia is the second most important citrus region in Brazil, accounting for 5.5% of Brazilian production. 80% of this production comes from family based farms, which depend on this crop for economic support. Huanglongbing (HLB) was never recorded in Bahia, but is already spreading in three other citrus-producing states of the country, one of which borders the state of Bahia. Thus, this study aimed to estimate the potential economic impact resulting from an eventual introduction of HLB in Bahia. The mathematical model of Gompertz and a logistic model were used to determine the epidemiological pattern of the disease, considering three scenarios. In scenario A, the efforts of the Bahia State Agency of Agricultural Defense were positive preventing the establishment of HLB (baseline scenario). In scenario B, there was the introduction of the bacteria into Bahia citrus orchards, and the absence of control measures contributed to the expansion of HLB in the following years. In scenario C, after detection of the disease, the producers would adopt control measures: eradication of symptomatic hosts and the insect vector population suppression. The costs of disease control were measured by the need for sprays, carrying out periodic inspections and eradication of plants with symptoms. The net present value (NPV) was used for comparing different scenarios. The results showed that, if HLB is introduced in Bahia, the losses would be very significant in the following 20 years. Should control and eradication procedures not be followed, losses of up to US $ 890,7 million could occur.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/1jj468hr", "frozenauthors": [ { "first_name": "J.", "middle_name": "M.C.", "last_name": "Oliveira", "name_suffix": "", "institution": "", "department": "None" }, { "first_name": "S.", "middle_name": "X.B.", "last_name": "Silva", "name_suffix": "", "institution": "Laboratory of Epidemiology and Health Information Technology / Bahia State Agency of Agricultural Defense (ADAB), Salvador/BA, Brazil", "department": "None" }, { "first_name": "A.", "middle_name": "S.", "last_name": "Nascimento", "name_suffix": "", "institution": "Embrapa Cassava & Fruits, Cruz das Almas/BA, Brasil", "department": "None" }, { "first_name": "S.", "middle_name": "H.G.", "last_name": "Miranda", "name_suffix": "", "institution": "ESALQ/Universidade de São Paulo, Piracicaba/SP, Brasil", "department": "None" }, { "first_name": "C.", "middle_name": "J.", "last_name": "Barbosa", "name_suffix": "", "institution": "Embrapa Cassava & Fruits, Cruz das Almas/BA, Brasil", "department": "None" }, { "first_name": "F.", "middle_name": "F.", "last_name": "Laranjeira", "name_suffix": "", "institution": "Embrapa Cassava & Fruits, Cruz das Almas/BA, Brasil", "department": "None" } ], "date_submitted": "2014-12-17T21:36:41+01:00", "date_accepted": "2014-12-17T21:36:41+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41310/galley/30909/download/" } ] }, { "pk": 41279, "title": "Evaluating the Biological Control of ACP in the Rio Grande Valley of Texas", "subtitle": null, "abstract": "Tamarixia radiata\n, a species specific ectoparasitoid of the Asian citrus psyllid (ACP), \nDiaphorina citri\n, was imported from Pakistan and permitted by the PPQ Permitting Unit for field release in Texas. Over 130,000 parasitoids have been released in the Lower Rio Grande Valley with establishment confirmed at 39 locations. Both open and closed releases are conducted and used to assess establishment and efficacy. Closed releases made in fine-mesh sleeve cages indicate parasitism levels at 10.4%. When compared to the controls, host mortality is reported at 64.9% in cages with parasitoids present versus 4.4% in cages with parasitoids absent. Further investigations into the host mortality of ACP nymphs have been explored by conducting visual observations on the behavior of female parasitoids (n = 30) for one-hour periods in arenas with suitable hosts. Data indicates that females will mount 3.1 + 0.5 nymphs per hour. The parasitoid will either oviposit the nymph on the ventral side (36.5% of the time) or probe the nymph on the dorsal side (63.5% of the time). After probing, the parasitoid will either walk away (87.9% of the time) or host feed (12.1% of the time). Host feeding was documented at 0.43 + 0.1 nymphs per hour. All nymphs that were host-fed were found to be eventually dead. Host mortality (64.9%) and parasitism rates (10.4%) combined can reduce ACP populations by 75.3%. Studies are still ongoing to help reduce both ACP populations and the incidence of citrus greening disease.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/02d3r6rn", "frozenauthors": [ { "first_name": "Daniel", "middle_name": "", "last_name": "Flores", "name_suffix": "", "institution": "USDA APHIS PPQ CPHST Mission Laboratory\n22675 N. Moorefield Rd. - Edinburg, TX 78541-5033", "department": "None" }, { "first_name": "Andrew", "middle_name": "", "last_name": "Parker", "name_suffix": "", "institution": "USDA APHIS PPQ CPHST Mission Laboratory\n22675 N. Moorefield Rd. - Edinburg, TX 78541-5033", "department": "None" }, { "first_name": "Jose", "middle_name": "", "last_name": "Martinez", "name_suffix": "", "institution": "USDA APHIS PPQ CPHST Mission Laboratory\n22675 N. Moorefield Rd. - Edinburg, TX 78541-5033", "department": "None" }, { "first_name": "Eustorjio", "middle_name": "", "last_name": "Rivas", "name_suffix": "", "institution": "USDA APHIS PPQ CPHST Mission Laboratory\n22675 N. Moorefield Rd. - Edinburg, TX 78541-5033", "department": "None" }, { "first_name": "Matt", "middle_name": "", "last_name": "Ciomperlik", "name_suffix": "", "institution": "USDA APHIS PPQ CPHST Mission Laboratory\n22675 N. Moorefield Rd. - Edinburg, TX 78541-5033", "department": "None" } ], "date_submitted": "2014-12-16T23:35:07+01:00", "date_accepted": "2014-12-16T23:35:07+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41279/galley/30878/download/" } ] }, { "pk": 41316, "title": "Evaluation of antibiotics against the bacteria, Candidatus Liberibacter for control of citrus Huanglongbing", "subtitle": null, "abstract": "Citrus Huanglongbing (HLB) is one of the most serious diseases of citrus worldwide. The present study was undertaken to screen antibiotics against \nCandidatus \nLiberibacter asiaticus (Las) while simultaneously assessing phytotoxicity to citrus. Twenty-eight antibiotics from ten classes of medical-antibiotics and three agricultural-antibiotics were tested for\n in vivo\n activities against HLB bacterium using the previously optimized graft-based chemotherapy method (Zhang et al., 2012). First, samples for DNA extraction were taken at 4 months after inoculation; subsequent samplings were taken at 2 month intervals. The Las-infected plants were considered as Las positive by real-time qPCR with threshold cycle (Ct) values less than 32.0. The efficiency against the HLB bacterium of each compound was evaluated by Ct values in the inoculated plants (both scions and rootstocks), scion infected percentage and HLB bacterial transmission percentage. The phytotoxicity was determined by the survival and growth of scions treated by antibiotics. The results showed that beta-lactam antibiotics (Ampicillin, Pennicillin and Carbenicillin) were highly effective in eliminating the HLB bacteria, with undetectable Las titers in the inoculated plants by qPCR, and had no phytotoxicity to citrus, with more than 75% scion survival. Antibiotics sulfonamide and tetracycline suppressed the HLB bacterium with Ct values of 35.7 on average, less than 30% scion infection and 16.9% Las-transmission percentage. The effectiveness of some antibiotics, such as aminoglycoside and quinolone, depended on their absorptions and permeability throughout the citrus tree. Peptide antibiotics were not effective in eliminating or suppressing Las bacterium with less than 28.0 Ct values by qPCR and higher scion infection percentages and Las transmission rates. Three agric-antibiotics, Actidione, Validoxylamine A and Zhongsenmycin, were also effective in eliminating the HLB bacteria. Antibiotic combinations, such as beta-lactam and aminoglycoside, are suggested as future applications.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/4xj6p6qd", "frozenauthors": [ { "first_name": "Muqing", "middle_name": "", "last_name": "Zhang", "name_suffix": "", "institution": "Indian River Research and Education Center, IFAS-UF, Fort Pierce, FL 34945,USA;\nUSDA-ARS, US Horticultural Lab, Fort Pierce, FL 34945,USA;\nState Key Lab for Conservation and Utilization of Subtropical Agro-bioresources, Guangxi Univ.,Guangxi 530004, China", "department": "None" }, { "first_name": "Ying", "middle_name": "", "last_name": "Guo", "name_suffix": "", "institution": "Indian River Research and Education Center, IFAS-UF, Fort Pierce, FL 34945,USA", "department": "None" }, { "first_name": "Charles", "middle_name": "A.", "last_name": "Powell", "name_suffix": "", "institution": "Indian River Research and Education Center, IFAS-UF, Fort Pierce, FL 34945,USA", "department": "None" }, { "first_name": "Yongping", "middle_name": "", "last_name": "Duan", "name_suffix": "", "institution": "USDA-ARS, US Horticultural Lab, Fort Pierce, FL 34945,USA", "department": "None" } ], "date_submitted": "2014-12-17T23:39:55+01:00", "date_accepted": "2014-12-17T23:39:55+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41316/galley/30915/download/" } ] }, { "pk": 41303, "title": "Evaluation of enhanced nutritional programs for mitigating HLB damage", "subtitle": null, "abstract": "Florida growers have reported that enhanced nutritional programs (ENPs) maintain productivity of HLB-infected trees. However, efficacy and sustainability of the nutritional approach for HLB disease management remains uncertain. Complementary studies of multiple ENPs and their individual components compared to the standard nutritional program (SNP) on nursery and field trees were initiated in 2010. Two independent nursery trials were initiated with final data collection of the second trial currently underway. The field site was chosen for its mix of healthy, presymptomatic, and HLB symptomatic trees to determine if observed differences resulted from effects on healthy or infected trees. We have found no evidence of reduced phloem plugging in ENP treated nursery trees. \nCandidatus \nLiberibacter asiaticus (Las) populations are similar for ENPs and the SNP. Minor differences in Las movement have been observed. Las invaded new flush tissue faster in ENP treated trees than SNP trees. Phosphite treatments have caused Las to favor early invasion of root tissue compared to other treatments. Preliminary observations of the second nursery trial suggest that foliar symptoms are more apparent on the standard nutrient program compared to ENPs; however, root and canopy decline are unaffected. Fruit yield and HLB symptoms in field trees treated with ENPs have not differed significantly from the standard nutritional program after two years. Third year yield data will be presented.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/52g6j59x", "frozenauthors": [ { "first_name": "E.", "middle_name": "G.", "last_name": "Johnson", "name_suffix": "", "institution": "UF-CREC, Lake Alfred, FL, USA", "department": "None" }, { "first_name": "M.", "middle_name": "S.", "last_name": "Irey", "name_suffix": "", "institution": "US Sugar Corp., Clewiston, FL USA", "department": "None" }, { "first_name": "T.", "middle_name": "", "last_name": "Gast", "name_suffix": "", "institution": "US Sugar Corp., Clewiston, FL USA", "department": "None" }, { "first_name": "D.", "middle_name": "B.", "last_name": "Bright", "name_suffix": "", "institution": "UF-CREC, Lake Alfred, FL, USA", "department": "None" }, { "first_name": "J.", "middle_name": "H.", "last_name": "Graham", "name_suffix": "", "institution": "UF-CREC, Lake Alfred, FL, USA", "department": "None" } ], "date_submitted": "2014-12-17T20:44:41+01:00", "date_accepted": "2014-12-17T20:44:41+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41303/galley/30902/download/" } ] }, { "pk": 41321, "title": "Evaluation of Thermotherapy against Huanglongbing (Citrus Greening) under Laboratory Conditions", "subtitle": null, "abstract": "Huanglongbing (HLB, citrus greening) is the most destructive disease of citrus. The disease is associated with “\nCandidatus \nLiberibacter asiaticus”. Few management options are available, besides preventive measures such as the removal of affected plants, planting disease-free stock and maintaining vector-free production in quarantine areas. In this study, we assessed the efficacy of thermotherapy against the disease under controled laboratory conditions. A total of sixty, 2-year old graft-infected \nCitrus reticulate \nBlanco seedlings were used for the study. The plants were randomly divided into 3 treatment groups (45, 48°C, and untreated), with 5 plants/rep, 4 reps/trt. The treated plants were placed in temperature chambers for a 4-h treatment sessions, repeated weekly 3 times. Disease remission was observed beginning 8 weeks post-treatment. Real-time PCR assays revealed that pathogen “\nCa\n. L. asiaticus” concentration of all HLB-affected seedlings were significantly reduced except for 8 plants under 45 and 48°C treatments at 4 weeks after treatment. In contrast, pathogen concentration in the untreated control plants exhibited a significant increase, with the highest increase of about 30-fold compared to the initial pathogen concentration (pre-treatment). Except for 7 plants (7 out of 40 total plants), pathogen concentration in the new flushes of the treated plants decreased 90% at ca. 8 weeks after treatment, compared to the initial pathogen concentration. Nested and real-time PCR were used for confirmation of HLB infection in the seedlings, and for pathogen titer assessment.\n \nAlthough the result is considered preliminary, it provides a foundation for further work in developing the technique for HLB management. Complementary work will include exploration of additional exposure time and temperature combinations as well as treatments using commercial field settings.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/7sq3t7mr", "frozenauthors": [ { "first_name": "Guocheng", "middle_name": "", "last_name": "Fan", "name_suffix": "", "institution": "Fruit Research Institute, Fujian Academy of Agricultural Sciences, Fuzhou, Fujian, China, 350013", "department": "None" }, { "first_name": "Yulu", "middle_name": "", "last_name": "Xia", "name_suffix": "", "institution": "NSF Center for Integrated Pest Management, North Carolina State University, Raleigh, NC 27606, USA", "department": "None" }, { "first_name": "Xiongjie", "middle_name": "", "last_name": "Lin", "name_suffix": "", "institution": "Fruit Research Institute, Fujian Academy of Agricultural Sciences, Fuzhou, Fujian, China, 350013", "department": "None" }, { "first_name": "Zijian", "middle_name": "", "last_name": "Cai", "name_suffix": "", "institution": "Fruit Research Institute, Fujian Academy of Agricultural Sciences, Fuzhou, Fujian, China, 350013", "department": "None" }, { "first_name": "Hanqing", "middle_name": "", "last_name": "Hu", "name_suffix": "", "institution": "Fruit Research Institute, Fujian Academy of Agricultural Sciences, Fuzhou, Fujian, China, 350013", "department": "None" }, { "first_name": "Xianda", "middle_name": "", "last_name": "Wang", "name_suffix": "", "institution": "Fruit Research Institute, Fujian Academy of Agricultural Sciences, Fuzhou, Fujian, China, 350013", "department": "None" }, { "first_name": "Chuanqing", "middle_name": "", "last_name": "Ruan", "name_suffix": "", "institution": "Agricultural Bio-Resources Research Institute, Fujian Academy of Agricultural Sciences, Fuzhou, Fujian, China, 350003", "department": "None" }, { "first_name": "Lianming", "middle_name": "", "last_name": "Lu", "name_suffix": "", "institution": "Zhejiang Citrus Research Institute, Taizhou, Zhejiang, China, 318020", "department": "None" }, { "first_name": "Ronald", "middle_name": "", "last_name": "Sequeira", "name_suffix": "", "institution": "The United States Department of Agriculture, Animal and Plant Health Inspection Service, Plant Protection and Quarantine, Center for Plant Health Science and Technology, Raleigh, NC 27606, USA", "department": "None" }, { "first_name": "Bo", "middle_name": "", "last_name": "Liu", "name_suffix": "", "institution": "Agricultural Bio-Resources Research Institute, Fujian Academy of Agricultural Sciences, Fuzhou, Fujian, China, 350003", "department": "None" } ], "date_submitted": "2014-12-18T00:00:50+01:00", "date_accepted": "2014-12-18T00:00:50+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41321/galley/30920/download/" } ] }, { "pk": 41381, "title": "Evidence that ‘flying dragon’ trifoliate orange delays HLB symptom expression for four sweet orange cultivars, Tahiti lime and Okitsu mandarin", "subtitle": null, "abstract": "Huanglongbing (HLB), caused by \nCandidatus\n Liberibacter asiaticus and vectored by \nDiaphorina citri\n, was first reported in 2004 in Brazil and is currently widespread in São Paulo State. Brazil is the world’s largest sweet orange producer and has 49,000 ha cultivated with ‘Tahiti’ lime acid lime. Mandarin cultivation represents 5.5% of total citrus production in the country. In 2001, three experiments were planted in the Citrus Experimental Station (EECB), Bebedouro, Northern São Paulo State, where the first HLB symptomatic tree was detected in 2006. The initial objective was to evaluate the performance of ‘Folha Murcha’ sweet orange, ‘Tahiti’ acid lime and ‘Okitsu’ mandarin grafted on twelve rootstocks including Rangpur lime, Swingle citrumelo, Rubidoux and Flying Dragon (FD) trifoliate oranges. Cumulative HLB incidence (CI) was calculated in 2009. Folha Murcha and Tahiti lime trees on FD had lower CI values (6.7 and 10%) than trees on Rangpur lime (33.3 and 80%), Swingle citrumelo (46.7 and 66.7%) and Rubidoux (46.7 and 60%). CI was similar for Okitsu on FD, Carrizo citrange and HRS 827 (11.1%). In another field trial at EECB, Valencia, Hamlin and Natal were planted on FD in November 1994. Drip irrigation was installed in 2001. The first symptomatic plants in the area were detected in November 2008. In 2010, the 16 yr-old trees on FD have a lower CI (5.6%) than 20 yr-old sweet orange trees on Swingle citrumelo in an adjacent trial (CI = 35.4%). Our results indicated that FD rootstock could prolong the longevity of citrus orchards but more well-controlled studies of scion-rootstocks combinations with and without vector management are required.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/3vt27053", "frozenauthors": [ { "first_name": "E.", "middle_name": "S.", "last_name": "Stuchi", "name_suffix": "", "institution": "Embrapa Cassava & Tropical Fruits, Cruz das Almas, Brazil; \nCitrus Experimental Station, Bebedouro, Brazil", "department": "None" }, { "first_name": "E.", "middle_name": "T.", "last_name": "Reiff", "name_suffix": "", "institution": "Citrus Experimental Station, Bebedouro, Brazil", "department": "None" }, { "first_name": "O.", "middle_name": "R.", "last_name": "Sempionato", "name_suffix": "", "institution": "Citrus Experimental Station, Bebedouro, Brazil", "department": "None" }, { "first_name": "L.", "middle_name": "G.", "last_name": "Parolin", "name_suffix": "", "institution": "Citrus Experimental Station, Bebedouro, Brazil", "department": "None" }, { "first_name": "D.", "middle_name": "A.", "last_name": "Toledo", "name_suffix": "", "institution": "Citrus Experimental Station, Bebedouro, Brazil", "department": "None" } ], "date_submitted": "2014-12-23T20:28:59+01:00", "date_accepted": "2014-12-23T20:28:59+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41381/galley/30980/download/" } ] }, { "pk": 19642, "title": "Exilio y origen en tres cuentos hispanofilipinos de Edmundo Farolán", "subtitle": null, "abstract": "Exilio y origen en tres cuentos hispanofilipinos de Edmundo Farolán", "language": "en", "license": { "name": "none", "short_name": "none", "text": "", "url": "https://escholarship.org/terms" }, "keywords": [], "section": "Article", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/5mp787c5", "frozenauthors": [ { "first_name": "Juan", "middle_name": "Ramón", "last_name": "Nieto del Villar", "name_suffix": "", "institution": "", "department": "None" } ], "date_submitted": "2014-11-05T02:07:03+01:00", "date_accepted": "2014-11-05T02:07:03+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/transmodernity/article/19642/galley/9729/download/" } ] }, { "pk": 41351, "title": "Exploiting the Las and Lam phage for potential control of HLB", "subtitle": null, "abstract": "Huanglongbing (HLB) is a lethal disease of citrus caused by \nCa\n. L. asiaticus (Las), \nCa\n. L. americanus (Lam), and \nCa\n. L. africanus. Our published results demonstrate that Las carries a prophage with a lytic cycle that can become activated in plants to kill the Las cell that carries it. Our more recent results analyzing the complete genome of Lam (refer Wulff \net al\n abstract at this conference) demonstrates that it, too, carries a very similar prophage and apparent lytic cycle. Our goal is to try to develop a sensitive, multiwell, microtiter dish assay for high throughput screening of chemicals with ability to trigger the lytic cycle and potentially lead to a chemical treatment method to eliminate Las from infected trees, whether symptomatic with HLB or not. The intergenic region between the early and late genes of Las phage SC1 and SC2 (between locus tags gp120 and gp125) were cloned in both directions upstream of the\n lacZ\n reporter gene in \nE. coli\n. We then cloned and expressed predicted repressors and anti-repressors from Las to determine responsiveness of the reporter constructs. As expected, the predicted early gene reporters of both SC1 and SC2 were constitutively on and the late genes were constitutively off. However, the predicted repressors and antirepressors failed to function as predicted and a detailed examination of the intergenic region revealed that late gene expression is likely initiated in at least one other location. Additional putative late gene promoter regions are being analyzed.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/9795m6wx", "frozenauthors": [ { "first_name": "S.", "middle_name": "J.", "last_name": "Zhang", "name_suffix": "", "institution": "Plant Pathology Dept., University of Florida, Gainesville, FL, USA", "department": "None" }, { "first_name": "N.", "middle_name": "A.", "last_name": "Wulff", "name_suffix": "", "institution": "Departamento Científico, Fundecitrus, Araraquara, SP, Brazil", "department": "None" }, { "first_name": "L.", "middle_name": "A.", "last_name": "Fleites", "name_suffix": "", "institution": "Plant Pathology Dept., University of Florida, Gainesville, FL, USA", "department": "None" }, { "first_name": "Y.", "middle_name": "C.", "last_name": "Zhang", "name_suffix": "", "institution": "Plant Pathology Dept., University of Florida, Gainesville, FL, USA", "department": "None" }, { "first_name": "D.", "middle_name": "W.", "last_name": "Gabriel", "name_suffix": "", "institution": "Plant Pathology Dept., University of Florida, Gainesville, FL, USA", "department": "None" } ], "date_submitted": "2014-12-20T03:29:02+01:00", "date_accepted": "2014-12-20T03:29:02+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41351/galley/30950/download/" } ] }, { "pk": 6021, "title": "Exploring Power Systems Among California's Female Inmates", "subtitle": null, "abstract": "Exploring Power Systems Among California's Female Inmates", "language": "en", "license": { "name": "All rights reserved", "short_name": "Copyright", "text": "© the author(s). All rights reserved.", "url": "https://creativecommons.org/licenses/authors" }, "keywords": [], "section": "Articles", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/0364p2dc", "frozenauthors": [ { "first_name": "Julissa", "middle_name": "", "last_name": "Muniz", "name_suffix": "", "institution": "", "department": "None" } ], "date_submitted": "2014-11-23T05:57:07+01:00", "date_accepted": "2014-11-23T05:57:07+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "", "path": "https://journalpub.escholarship.org/our_buj/article/6021/galley/3659/download/" } ] }, { "pk": 6039, "title": "Exploring Young Adult Female Burn Survivors and Sexual Intimacy", "subtitle": null, "abstract": "Exploring Young Adult Female Burn Survivors and Sexual Intimacy", "language": "en", "license": { "name": "All rights reserved", "short_name": "Copyright", "text": "© the author(s). All rights reserved.", "url": "https://creativecommons.org/licenses/authors" }, "keywords": [], "section": "Articles", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/4kx052rb", "frozenauthors": [ { "first_name": "Huyen", "middle_name": "", "last_name": "Vo", "name_suffix": "", "institution": "", "department": "None" } ], "date_submitted": "2014-11-23T06:26:10+01:00", "date_accepted": "2014-11-23T06:26:10+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "", "path": "https://journalpub.escholarship.org/our_buj/article/6039/galley/3677/download/" } ] }, { "pk": 34750, "title": "EXPOSING THE INSTITUTIONS THAT MASK US", "subtitle": null, "abstract": "I am going to stand in tribute to Professor Montoya and her family and to the Chicana/o-Latina/o Law Review, which brings us to this point where we are considering and celebrating Professor Montoya’s \nMáscaras, Trenzas, Y Greñas: Un/Masking the Self While Un/Braiding Latina Stories and Legal Discourse\n, twenty years after its initial publication. Professor Montoya’s article is timeless.", "language": "en", "license": { "name": "", "short_name": "", "text": null, "url": "" }, "keywords": [ { "word": "Christine Zuni Cruz, Mascaras, CLLR, Chicana/o-Latina/o Law Review, Latina, Latino, Chicano Studies, Chicano, Margaret Montoya, Race, equality, social justice, racial justice, law, narrative, critic.." } ], "section": "Articles", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/1523b84s", "frozenauthors": [ { "first_name": "Christine", "middle_name": "", "last_name": "Zuni Cruz", "name_suffix": "", "institution": "", "department": "None" } ], "date_submitted": "2014-05-25T07:09:58+02:00", "date_accepted": "2014-05-25T07:09:58+02:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/uclalaw_cllr/article/34750/galley/25894/download/" } ] }, { "pk": 41276, "title": "Extension Model to Improve Asian Ctrus Psyllid Control in Citrus Health Management Areas (CHMAs)", "subtitle": null, "abstract": "Citrus health management areas (CHMAs) have been implemented throughout Florida to provide regional coordination to manage Asian citrus psyllid (ACP) and spread of HLB. The Gulf CHMA is going into its 5th season of cooperative action toward these goals. During the fourth (2011-2012) season we began providing GULF CHMA updates and interactive maps from CHRP data available on the CHMA website www.flchma.com, showing ACP levels and 'hot spots' (i.e. tap samples > 21 ACP for 3 consecutive cycles) on our website, www.imok.ufl.edu. The ring color of the proportional circle map designates the cycle, and the ring size the number of A adults per 50 taps. The largest ring represents psyllid numbers of 21 or greater. The map is readable by anyone with Adobe Reader, and it allows you to click on and off different cycle layers and view data for Cycle #, Cycle Date, County Name, and ACP # thus allowing comparison between two or more sets of data simultaneously and spatially. This project includes development and testing of a smart phone spray app for use by growers and consultants. The insecticide spray data will be converted to a map layer that overlays the Gulf CHMA psyllid counts to determine which growers may need help and what chemicals appear to be failing -- a precursor to predicting ACP resistance. We expect to build better working relationships with the growers by offering individual support of their economic efforts, ACP management, and HLB control.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/01r4f6m0", "frozenauthors": [ { "first_name": "Moneen", "middle_name": "M.", "last_name": "Jones", "name_suffix": "", "institution": "UF-SWFREC/IFAS, 2685 SR 29 N, Immokalee, FL 34142", "department": "None" }, { "first_name": "Philip", "middle_name": "A.", "last_name": "Stansly", "name_suffix": "", "institution": "UF-SWFREC/IFAS, 2685 SR 29 N, Immokalee, FL 34142", "department": "None" } ], "date_submitted": "2014-12-16T23:26:18+01:00", "date_accepted": "2014-12-16T23:26:18+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41276/galley/30875/download/" } ] }, { "pk": 59102, "title": "Fabricating Nano-Scale Devices: Block Copolymers and their Applications", "subtitle": null, "abstract": "", "language": "en", "license": null, "keywords": [], "section": "Features", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/8318n7q0", "frozenauthors": [ { "first_name": "Aditya", "middle_name": "", "last_name": "Limaye", "name_suffix": "", "institution": "University of California, Berkeley", "department": "" } ], "date_submitted": "2014-04-29T03:40:20+02:00", "date_accepted": "2014-04-29T03:40:20+02:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/our_bsj/article/59102/galley/45130/download/" } ] }, { "pk": 41313, "title": "Field validation of a greenhouse demonstration of phytohormone-mediated restoration of naturally infected HLB citrus in Florida, Texas and Jamaica", "subtitle": null, "abstract": "A model system based on restoration of the physiological phytohormone balance in the phloem-limited bacterium Candidatus Liberibacter asiaticus (Las) infected citrus (orange, mercot, tangelo and grapefruit) was evaluated in the field at Ft Meade, FL, Weslaco, TX and Kingston, Jamaica. We hypothesize that development of Citrus Greening Disease or Huanglongbing (HLB), is the result of the release of latent infection precipitated by phloem blockage, root disease and the demise of the mevalonate (MEV) pathway for phytohormone production and transport. Earlier greenhouse investigations with citrus seedlings and an alternative host, Periwinkle (Catharanthus roseus), indicate that exogenous application of some of the products of this pathway restore the internal phytohormone balance, reverse root decline, induce new axillary buds and restore vitality and production to the tree. This treatment program was scaled up and evaluated in the field with three commercial preparations applied in the fall or in the spring. A single foliar application in the fall provided superior restoration of growth and development. Treated trees were symptomless after 3 months, flowered, set and held fruit and produced over 550 mature fruit/tree. Additional investigations of phytohormone therapy are in progress to evaluate the impact on Las titer in both old (pretreatment) and new growth. Foliar application of selected phytohormones is an effective remediation treatment for Las infected citrus.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/9688s347", "frozenauthors": [ { "first_name": "R.", "middle_name": "", "last_name": "Woodward", "name_suffix": "", "institution": "Stoller Enterprises, Inc. 4001 W Sam Houston, Pkwy. N. Houston, TX, USA", "department": "None" }, { "first_name": "J.", "middle_name": "H.", "last_name": "Stoller", "name_suffix": "", "institution": "Stoller Enterprises, Inc. 4001 W Sam Houston, Pkwy. N. Houston, TX, USA", "department": "None" }, { "first_name": "A.", "middle_name": "", "last_name": "Liptay", "name_suffix": "", "institution": "Stoller Enterprises, Inc. 4001 W Sam Houston, Pkwy. N. Houston, TX, USA", "department": "None" }, { "first_name": "V.", "middle_name": "", "last_name": "Alvarado", "name_suffix": "", "institution": "Stoller Enterprises, Inc. 4001 W Sam Houston, Pkwy. N. Houston, TX, USA", "department": "None" } ], "date_submitted": "2014-12-17T21:42:29+01:00", "date_accepted": "2014-12-17T21:42:29+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41313/galley/30912/download/" } ] }, { "pk": 41216, "title": "First Detection of Huanglongbing and Implementation of its Mitigation Efforts in Texas", "subtitle": null, "abstract": "After six years of intensive statewide surveys, Huanglongbing (HLB) was first detected in two adjacent commercial groves in Texas in 2012, and \nCandidatus\n Liberibacter asiaticus (CLas) was found associated with the disease. Assessment of affected trees within the two infected groves was made by visual inspection of foliage and PCR-testing of symptomatic tissue. HLB-infected trees exhibited an aggregated distribution and a strong perimeter effect in the two groves. While in one grove (sweet orange), more qPCR positive trees were observed in the south-eastern side of the grove, in the other (grapefruit) more HLB-infected were found on the western border, adjacent to the sweet orange grove suggesting movement of infected psyllids between the two groves. The Asian psyllid vector, \nDiaphorina citri\n Kuwayama, known vector of CLas, reported for the first time in 2001, is widespread in Texas. In an effort to reduce the risk of HLB in Texas, a proactive area-wide psyllid control program was initiated in 2010 which has contributed to significant reduction of psyllid populations in Texas. The detection of HLB has led to an intensification of psyllid control measures in groves within a mile radius of the HLB-positive sites, both in commercial and residential settings. All known infected trees have been removed and a five mile-radius quarantine has been put in place to regulate movement of all Rutaceae plants and to ensure safe harvesting of citrus.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/7h01d3qc", "frozenauthors": [ { "first_name": "M.", "middle_name": "", "last_name": "Sétamou", "name_suffix": "", "institution": "Texas A&M University-Kingsville Citrus Center, Weslaco, Texas 78596, USA", "department": "None" }, { "first_name": "J.", "middle_name": "V.", "last_name": "da Graça", "name_suffix": "", "institution": "Texas A&M University-Kingsville Citrus Center, Weslaco, Texas 78596, USA", "department": "None" }, { "first_name": "M.", "middle_name": "", "last_name": "Kunta", "name_suffix": "", "institution": "Texas A&M University-Kingsville Citrus Center, Weslaco, Texas 78596, USA", "department": "None" } ], "date_submitted": "2014-10-09T01:08:27+02:00", "date_accepted": "2014-10-09T01:08:27+02:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41216/galley/30815/download/" } ] }, { "pk": 41359, "title": "First Report of ‘Candidatus Liberibacter asiaticus’ associated with huanglongbing in the weeds Cleome rutidosperma, Pisonia aculeata and Trichostigma octandrum in Jamaica", "subtitle": null, "abstract": "Citrus huanglongbing (HLB) also known as citrus greening is the most destructive disease of citrus worldwide. Three species of the causal organism have been identified. These are ‘Candidatus Liberibacter asiaticus’, ‘Ca. L. africanus’ and ‘Ca. L. americanus’ (Bové, 2006). In 2010 a survey of non-citrus plants was conducted on two major citrus producing farms in Clarendon and St Catherine in Jamaica. This was to determine the possibility of the existence of non-citrus hosts of HLB. A total of 120 plants belonging to 10 different species and nine families were collected over a period of two months. The plants collected included weeds as well as non-citrus trees. None of the plants collected exhibited any symptoms of HLB and at the time of sample collection, no citrus psyllids was observed on the plants. DNA was extracted from plant samples using the method of Dellaporta et al. (1983) and analysed by PCR using the primer pair OI1 (5` GCGCGTATGCAATACGAGCGGCA3`) and OI2c (5`GCCTCGCGACTTCGCAACCCAT 3`). DNA obtained from a confirmed HLB infected citrus plant from Florida served as the positive control whereas DNA from a citrus plant uninfected by HLB was used as the negative control.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/8dw9c1f5", "frozenauthors": [ { "first_name": "S.", "middle_name": "E.", "last_name": "Brown", "name_suffix": "", "institution": "Department of Basic Medical Sciences, University of the West Indies Mona, Kingston 7, Jamaica", "department": "None" }, { "first_name": "A.", "middle_name": "P.", "last_name": "Oberheim", "name_suffix": "", "institution": "Department of Basic Medical Sciences, University of the West Indies Mona, Kingston 7, Jamaica", "department": "None" }, { "first_name": "A.", "middle_name": "", "last_name": "Barrett", "name_suffix": "", "institution": "Jamaica Citrus Protection Agency, Bog Walk, St Catherine, Jamaica", "department": "None" }, { "first_name": "W.", "middle_name": "A.", "last_name": "McLaughlin", "name_suffix": "", "institution": "Department of Basic Medical Sciences, University of the West Indies Mona, Kingston 7, Jamaica", "department": "None" } ], "date_submitted": "2014-12-20T03:52:31+01:00", "date_accepted": "2014-12-20T03:52:31+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41359/galley/30958/download/" } ] }, { "pk": 34746, "title": "FOREWORD", "subtitle": null, "abstract": "Foreword and Editor's Note for Volume 32, Issue 2 of the Chicana/o-Latina/o Law Review.", "language": "en", "license": { "name": "", "short_name": "", "text": null, "url": "" }, "keywords": [ { "word": "Daniel Borca, Arifa Raza, Mascaras, CLLR, Chicana/o-Latina/o Law Review, Latina, Latino, Chicano Studies, Chicano, Margaret Montoya, Race, equality, social justice, racial justice, law, narrative, c.." } ], "section": "Foreword", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/58d1d98h", "frozenauthors": [ { "first_name": "Daniel", "middle_name": "J.", "last_name": "Borca", "name_suffix": "", "institution": "UCLA School of Law", "department": "None" }, { "first_name": "Arifa", "middle_name": "", "last_name": "Raza", "name_suffix": "", "institution": "UCLA School of Law", "department": "None" } ], "date_submitted": "2014-05-25T06:34:00+02:00", "date_accepted": "2014-05-25T06:34:00+02:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/uclalaw_cllr/article/34746/galley/25890/download/" } ] }, { "pk": 34745, "title": "FOREWORD: A TRIBUTE TO MARGARET MONTOYA", "subtitle": null, "abstract": "Dean Moran provides opening remarks to the Chicana/o-Latina/o Law Review symposium, \"Un/Masking Power: The Past, Present, and Future of Marginal Identities in Legal Academia.\"", "language": "en", "license": { "name": "", "short_name": "", "text": null, "url": "" }, "keywords": [ { "word": "Rachel Moran, Mascaras, CLLR, Chicana/o-Latina/o Law Review, Latina, Latino, Chicano Studies, Chicano, Margaret Montoya, Race, equality, social justice, racial justice, law, narrative, critical race.." } ], "section": "Articles", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/75v2q33h", "frozenauthors": [ { "first_name": "Rachel", "middle_name": "F.", "last_name": "Moran", "name_suffix": "", "institution": "", "department": "None" } ], "date_submitted": "2014-05-25T06:28:18+02:00", "date_accepted": "2014-05-25T06:28:18+02:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/uclalaw_cllr/article/34745/galley/25889/download/" } ] }, { "pk": 41289, "title": "Frequent Low Volume Sprays of Horticultural Mineral Oil (HMO) for Psyllid and Leafminer Control", "subtitle": null, "abstract": "Low volume (LV) aerial and ground sprays have become an important method of application in Florida citrus. During Feb 2011, we started a trial in a 10.9 acre plot of 'Valencia' orange in Lee County comparing LV spray of 435 HMO with the Grower Standard (GS) and an Untreated check (UC) in 3x3 Latin square design. A Proptec rotary atomizer P400D spray machine was used for all treatments. HMO was applied every 2 weeks at 2 gpa. Significantly fewer ACP were seen on during May 2011 on GS trees than HMO trees, but during June these differences disappeared. Between Aug – Oct 2011, mean adult ACP populations were lowest for GS, followed by HMO and UC. Thus, LV oil treatments suppressed ACP, though not as effectively as the GS. However during winter 2011 HMO treatments were as effective as GS. Also, highest pound solids were seen from trees receiving HMO followed by UC and GS. Citrus leafminer (CLM) damage assessments (May/July 2011) using a modified Horsfall-Barratt scale showed less damage with GS compared with Oil which in turn was less than UC. However, CLM trap catches in Nov were significantly lower with HMO compared to GS and UC even though highest flush density was present on HMO-treated trees. Canker ratings (2012) for HMO and GS have been significantly less than UC. Thus, LV application of 435 horticultural mineral oil (HMO) for control of ACP and CLM have shown promising results the last 2 years.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/1z03d071", "frozenauthors": [ { "first_name": "Moneen", "middle_name": "M.", "last_name": "Jones", "name_suffix": "", "institution": "UF-SWFREC/IFAS, 2685 SR 29 N, Immokalee, FL 34142", "department": "None" }, { "first_name": "Philip", "middle_name": "A.", "last_name": "Stansly", "name_suffix": "", "institution": "UF-SWFREC/IFAS, 2685 SR 29 N, Immokalee, FL 34142", "department": "None" } ], "date_submitted": "2014-12-17T01:26:12+01:00", "date_accepted": "2014-12-17T01:26:12+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41289/galley/30888/download/" } ] }, { "pk": 52626, "title": "From Spirit to Machine: American Expansion and the Dispossession of the Native Americans", "subtitle": null, "abstract": "", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "<p>Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use. No additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.</p>", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [ { "word": "History" }, { "word": "United States" }, { "word": "Expansion" }, { "word": "Native Americans" }, { "word": "manifest destiny" } ], "section": "Articles", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/40h5r294", "frozenauthors": [ { "first_name": "Alan", "middle_name": "", "last_name": "Kyle", "name_suffix": "", "institution": "UC Merced", "department": "" } ], "date_submitted": "2014-05-15T20:37:58+02:00", "date_accepted": "2014-05-15T20:37:58+02:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/ssha_uhj/article/52626/galley/39682/download/" } ] }, { "pk": 60221, "title": "[Front Matter]", "subtitle": null, "abstract": "[No abstract]", "language": "en", "license": { "name": "", "short_name": "", "text": null, "url": "" }, "keywords": [], "section": "Front Matter", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/09n5f37s", "frozenauthors": [ { "first_name": "Editors", "middle_name": "", "last_name": "ELR", "name_suffix": "", "institution": "", "department": "" } ], "date_submitted": "2015-04-25T18:33:02+02:00", "date_accepted": "2015-04-25T18:33:02+02:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/uclalaw_elr/article/60221/galley/46180/download/" } ] }, { "pk": 60220, "title": "[Front Matter]", "subtitle": null, "abstract": "[No abstract]", "language": "en", "license": { "name": "", "short_name": "", "text": null, "url": "" }, "keywords": [], "section": "Front Matter", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/4gs0285n", "frozenauthors": [ { "first_name": "Editors", "middle_name": "", "last_name": "ELR", "name_suffix": "", "institution": "", "department": "" } ], "date_submitted": "2015-04-25T18:32:17+02:00", "date_accepted": "2015-04-25T18:32:17+02:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/uclalaw_elr/article/60220/galley/46179/download/" } ] }, { "pk": 60722, "title": "Front Matter", "subtitle": null, "abstract": "Front Matter", "language": "en", "license": { "name": "", "short_name": "", "text": null, "url": "" }, "keywords": [], "section": "Front Matter", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/5688d53k", "frozenauthors": [ { "first_name": "UCLA", "middle_name": "", "last_name": "JELP", "name_suffix": "", "institution": "", "department": "" } ], "date_submitted": "2014-05-14T19:11:59+02:00", "date_accepted": "2014-05-14T19:11:59+02:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/uclalaw_jelp/article/60722/galley/46686/download/" } ] }, { "pk": 61235, "title": "Front Matter", "subtitle": null, "abstract": "[No abstract]", "language": "en", "license": { "name": "", "short_name": "", "text": null, "url": "" }, "keywords": [], "section": "Front Matter", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/59n5w45z", "frozenauthors": [ { "first_name": "Pacific Basin Law Journal", "middle_name": "", "last_name": "Editors", "name_suffix": "", "institution": "", "department": "" } ], "date_submitted": "2015-07-06T19:08:04+02:00", "date_accepted": "2015-07-06T19:08:04+02:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/uclalaw_pblj/article/61235/galley/47274/download/" } ] }, { "pk": 61232, "title": "Front Matter", "subtitle": null, "abstract": "[no abstract]", "language": "en", "license": { "name": "", "short_name": "", "text": null, "url": "" }, "keywords": [], "section": "Front Matter", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/2224t09v", "frozenauthors": [ { "first_name": "Editors", "middle_name": "", "last_name": "PBLJ", "name_suffix": "", "institution": "", "department": "" } ], "date_submitted": "2014-12-18T22:59:10+01:00", "date_accepted": "2014-12-18T22:59:10+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/uclalaw_pblj/article/61232/galley/47271/download/" } ] }, { "pk": 60715, "title": "Front Matter", "subtitle": null, "abstract": "Front Matter", "language": "en", "license": { "name": "", "short_name": "", "text": null, "url": "" }, "keywords": [], "section": "Front Matter", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/2zz5h7r0", "frozenauthors": [ { "first_name": "UCLA", "middle_name": "", "last_name": "Journal of Environmental Law", "name_suffix": "", "institution": "", "department": "" } ], "date_submitted": "2014-01-04T17:02:35+01:00", "date_accepted": "2014-01-04T17:02:35+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/uclalaw_jelp/article/60715/galley/46679/download/" } ] }, { "pk": 34752, "title": "Front Matter", "subtitle": null, "abstract": "", "language": "en", "license": { "name": "", "short_name": "", "text": null, "url": "" }, "keywords": [ { "word": "CLLR" } ], "section": "Front Matter", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/9s3510dp", "frozenauthors": [ { "first_name": "CLLR", "middle_name": "", "last_name": "N/A", "name_suffix": "", "institution": "Chicana/o Latina/o Law Review", "department": "None" } ], "date_submitted": "2014-05-28T05:06:56+02:00", "date_accepted": "2014-05-28T05:06:56+02:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/uclalaw_cllr/article/34752/galley/25896/download/" } ] }, { "pk": 52616, "title": "Front Matter", "subtitle": null, "abstract": "", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "<p>Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use. No additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.</p>", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Forematter", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/3f21911j", "frozenauthors": [ { "first_name": "Rocco", "middle_name": "", "last_name": "Bowman", "name_suffix": "", "institution": "", "department": "" } ], "date_submitted": "2014-05-15T20:19:19+02:00", "date_accepted": "2014-05-15T20:19:19+02:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/ssha_uhj/article/52616/galley/39672/download/" } ] }, { "pk": 56465, "title": "Front Matter", "subtitle": null, "abstract": "[no abstract]", "language": "en", "license": null, "keywords": [], "section": "Front Matter", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/5mg5m8fr", "frozenauthors": [ { "first_name": "Editorial Board", "middle_name": "", "last_name": "Ufahamu: A Journal of African Studies", "name_suffix": "", "institution": "", "department": "" } ], "date_submitted": "2014-12-14T04:36:45+01:00", "date_accepted": "2014-12-14T04:36:45+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/ufahamu/article/56465/galley/42873/download/" } ] }, { "pk": 37752, "title": "Front Matter and Table of Contents", "subtitle": null, "abstract": "Mester 43 Front Matter and Table of Contents", "language": "en", "license": { "name": "Copyright", "short_name": "Copyright", "text": "", "url": "https://escholarship.org/terms" }, "keywords": [], "section": "Front Matter", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/7m57v6rv", "frozenauthors": [ { "first_name": "Rafael", "middle_name": "", "last_name": "Ramírez Mendoza", "name_suffix": "", "institution": "UCLA", "department": "None" } ], "date_submitted": "2015-10-15T00:07:53+02:00", "date_accepted": "2015-10-15T00:07:53+02:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/mester/article/37752/galley/28468/download/" } ] }, { "pk": 37656, "title": "Fuchs, Barbara. The Poetics of Piracy: Emulating Spain in English Literature", "subtitle": null, "abstract": "Review of The Poetics of Piracy by Barbara Fuchs", "language": "en", "license": { "name": "Copyright", "short_name": "Copyright", "text": "", "url": "https://escholarship.org/terms" }, "keywords": [ { "word": "Barbara Fuchs" }, { "word": "Poetics of Piracy" }, { "word": "English Literature" }, { "word": "Ben Johnson" }, { "word": "Francis Beaumont" }, { "word": "Thomas Middleton" }, { "word": "Cardenio" } ], "section": "Reviews", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/6q63s25c", "frozenauthors": [ { "first_name": "Robert", "middle_name": "", "last_name": "Richmond Ellis", "name_suffix": "", "institution": "Occidental College", "department": "None" } ], "date_submitted": "2013-12-23T08:59:41+01:00", "date_accepted": "2013-12-23T08:59:41+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/mester/article/37656/galley/28428/download/" } ] }, { "pk": 41307, "title": "Further Studies on the Effects of Greening on Juice Quality: Do Nutritional Sprays Ameliorate HLB-Induced Off-flavor?", "subtitle": null, "abstract": "Citrus groves receiving nutritional sprays were compared with groves in the same areas managed with conventional fertilization treatments. Fruit were harvested from healthy and Huanglongbing (HLB)-affected trees. Within HLB-affected trees, fruit were sorted into asymptomatic (HLB-a) and symptomatic (HLB-s) fruit. Sensory tests were performed using the difference-from-control (DFC) method, where juice from HLB-affected trees was compared with juice from healthy trees. Results show that panelists could detect differences between juice from HLB-affected and healthy trees in the 2009-2010 and 2010-2011 seasons, regardless of nutritional treatments, for Hamlin and Valencia. Like in previous years, those differences were perceived as more bitter or metallic for early harvests of HLB-affected Hamlin, but those differences were less and inconsistently perceived as more bitter, sweeter or more sour for late harvests or Valencia HLB-affected fruit. In the 2011-2012 season, there were much less differences between juice from healthy and HLB trees, possibly due to a season with high Brix/TA ratio, or due to later harvests. Results will be discussed in relation to chemical analysis of sugars, acids, and limonoids. Nutritional treatments that mitigate HLB symptoms on trees did not have a consistent effect on the HLB induced off-flavor of the fruit and juice, necessitating more seasons of study.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/1421b2jb", "frozenauthors": [ { "first_name": "Anne", "middle_name": "", "last_name": "Plotto", "name_suffix": "", "institution": "USDA-ARS, USHRL, Fort Pierce, USA", "department": "None" }, { "first_name": "Sharon", "middle_name": "", "last_name": "Dea", "name_suffix": "", "institution": "USF Tampa, USA, 3U.S. Sugar Corporation, Clewiston, FL, USA", "department": "None" }, { "first_name": "Jinhe", "middle_name": "", "last_name": "Bai", "name_suffix": "", "institution": "USDA-ARS, USHRL, Fort Pierce, USA", "department": "None" }, { "first_name": "John", "middle_name": "", "last_name": "Manthey", "name_suffix": "", "institution": "USDA-ARS, USHRL, Fort Pierce, USA", "department": "None" }, { "first_name": "Cecilia", "middle_name": "N.", "last_name": "Nunes", "name_suffix": "", "institution": "USF Tampa, USA, 3U.S. Sugar Corporation, Clewiston, FL, USA", "department": "None" }, { "first_name": "Jan", "middle_name": "", "last_name": "Narciso", "name_suffix": "", "institution": "USDA-ARS, USHRL, Fort Pierce, USA", "department": "None" }, { "first_name": "Mike", "middle_name": "", "last_name": "Irey", "name_suffix": "", "institution": "United States Sugar Corporation/Southern Gardens Citrus, Clewiston, FL, USA", "department": "None" }, { "first_name": "Liz", "middle_name": "", "last_name": "Baldwin", "name_suffix": "", "institution": "USDA-ARS, USHRL, Fort Pierce, USA", "department": "None" } ], "date_submitted": "2014-12-17T21:17:38+01:00", "date_accepted": "2014-12-17T21:17:38+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41307/galley/30906/download/" } ] }, { "pk": 41282, "title": "Generating Asian citrus Psyllid Diaphorina citri Kuwayama (Homoptera: Psyllidae) with twisting wings to prevent the spread of citrus greening disease", "subtitle": null, "abstract": "Huanglongbing (HLB) is seriously threatening and causing considerable economic losses to the citrus groves. Its Management depends critically on the control of the Asian citrus Psyllid (ACP), the vector of the cause of HLB,\n Candidatus\n Liberibacter asiaticus bacteria (\nC\nLas). Silencing genes by RNA interference (RNAi) is a promising technique to control pests. In this study, the abnormal disk wing (awd) has been selected from the available psyllid annotated genome. It has been known that awd gene encodes a nucleoside diphosphate kinase and is associated with wing development. This research focused on the effect of RNAi of awd gene on ACP nymph instars that acquired dsRNA. The Results provide evidence that using the dsRNA of awd gene has diminished the development and survival of ACP nymphs. Moreover, knockdown of awd gene expression was observed through malformation of adult wings. Also, the expression of awd was messured by quantitative PCR (qPCR). Furthermore, we are conducting experiments to investigate awd's possible contribution in temperature tolerance. We attempt to establish effective practical application to prevent the spread of HLB in friendly environmentally strategy.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/5dj43505", "frozenauthors": [ { "first_name": "I.", "middle_name": "", "last_name": "El-Shesheny", "name_suffix": "", "institution": "", "department": "None" }, { "first_name": "S.", "middle_name": "", "last_name": "Harjeri", "name_suffix": "", "institution": "", "department": "None" }, { "first_name": "S.", "middle_name": "", "last_name": "Gowda", "name_suffix": "", "institution": "", "department": "None" }, { "first_name": "N.", "middle_name": "", "last_name": "Killiny", "name_suffix": "", "institution": "", "department": "None" } ], "date_submitted": "2014-12-16T23:39:52+01:00", "date_accepted": "2014-12-16T23:39:52+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41282/galley/30881/download/" } ] }, { "pk": 41374, "title": "Genetic transformation of sweet orange to overexpress a CsPR-8 gene aiming for Candidatus Liberibacter asiaticus resistance", "subtitle": null, "abstract": "A strategy to produce HLB-resistant citrus using genetic engineering is the overexpression of genes identified in the citrus genome. Plants respond to pathogen attacks by producing several pathogenesis-related (PR) proteins. Therefore, individual PR overexpression in transgenic plants can lead to an increased resistance. In this study, we have chosen to use one \nPR-8\n isoform cloned from \nCitrus sinensis \n(\nCsPR-8\n). The PR-8 is an endochitinase that also has lysozyme activity, to be potentially used against bacterial attacks. We constructed an expression transformation vector (pCAMBIA2201) containing the \nCsPR-8\n gene and the selection gene \nnpt\nII that confers kanamycin resistance in plants, both driven by the CaMV35S constitutive promoter. Epicotyl segments collected from \nin vitro \nseedlings of ‘Hamlin’ sweet orange (\nCitrus sinensis\n L. Osbeck) were used for transformation via \nAgrobacterium tumefaciens\n strain EHA105. The developed shoots were excised from the explants and \nin vitro\n grafted onto Carrizo citrange [\nC. sinensis\n x \nPoncirus trifoliata\n (L.) Raf] seedlings. The grafted plants were analyzed by PCR, using specific primers for detection of the \nnpt\nII gene. Acclimation of transgenic plants is under way in order to be transferred to the greenhouse. These plants will be analyzed by Southern blot to confirm the integration of the transgene and by RT-qPCR to evaluate the transgene expression, prior to their evaluation for \nCandidatus\n Liberibacter asiaticus resistance.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/9bz1w1hc", "frozenauthors": [ { "first_name": "F.", "middle_name": "A.A.", "last_name": "Mourão Filho", "name_suffix": "", "institution": "Universidade de São Paulo/ESALQ, Piracicaba, Brazil", "department": "None" }, { "first_name": "L.", "middle_name": "C.L.", "last_name": "Stipp", "name_suffix": "", "institution": "Universidade de São Paulo/ESALQ, Piracicaba, Brazil", "department": "None" }, { "first_name": "A.", "middle_name": "B.", "last_name": "Beltrame", "name_suffix": "", "institution": "Universidade de São Paulo/ESALQ, Piracicaba, Brazil", "department": "None" }, { "first_name": "R.", "middle_name": "L.", "last_name": "Boscariol-Camargo", "name_suffix": "", "institution": "Centro de Citricultura Sylvio Moreira/IAC, Cordeirópolis, Brazil", "department": "None" }, { "first_name": "R.", "middle_name": "", "last_name": "Harakava", "name_suffix": "", "institution": "Instituto Biológico, Seção de Bioquímica Fitopatológica, São Paulo, Brazil", "department": "None" }, { "first_name": "B.", "middle_name": "M.J.", "last_name": "Mendes", "name_suffix": "", "institution": "Universidade de São Paulo/CENA, Piracicaba, Brazil", "department": "None" } ], "date_submitted": "2014-12-23T01:08:02+01:00", "date_accepted": "2014-12-23T01:08:02+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41374/galley/30973/download/" } ] }, { "pk": 41337, "title": "Genome-wide Expression Profiling in Ponkan Infected by Candidatus Liberibacter asiaticus", "subtitle": null, "abstract": "Huanglongbing (HLB) is an economical and destructive disease of citrus in South China, such as in Guangdong, Guangxi that is caused by the bacterium\n Candidatus\n Liberibacter asiaticus. The interaction at mRNA level between pathogen and citrus (Ponkan, \nCitrus reticulata\n Blanco ) was primarily researched by Digital Gene Expression Tag Profiling. Ponkan leaves at 13 weeks and 26 weeks after HLB inoculation were used for analysis. The numbers of up-regulated genes were increased from 37% in 13 wpi (weeks post inoculation) to 64% in 26 wpi. The differentially expressed genes (DEGs) fold change increased more than 8 times from 16.7% to 87.3%. Gene ontology (GO) process molecular function enrichment analysis showed that the DEGs with oxidation reduction function increased from 4.41% to 8.48% and that DEGs responsive to stresses increased from 1.10% to 2.08%, but those related to defense responses decreased from 0.74% to 0.64%. However, those related to defense responses of down-regulated genes increased from 0.55% to 0.79%. Apparently, the expression level of resistance genes strengthened, while the defense ability of host declined along with enhanced stresses caused by HLB infection. Photosynthesis-related genes were down-regulated at both 13 wpi and 26 wpi, which indicated that HLB infection greatly reduced the citrus photosynthesis, perhaps via feedback regulation of the accumulated starches resulted from blockage of sieve tubes by the bacteria in the phloem tissue. RIN4,a negative regulator of plant immunity, was also found up-regulated by approximately 9-fold.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/1k0036p1", "frozenauthors": [ { "first_name": "Bo", "middle_name": "", "last_name": "Jiang", "name_suffix": "", "institution": "Key Laboratory of South Subtropical Fruit Biology and Genetic Resource Utilization, Ministry of Agriculture, Institute of Fruit Tree Research, Guangdong Academy of Agricultural Science, Guangzhou 510640, China", "department": "None" }, { "first_name": "Yun", "middle_name": "", "last_name": "Zhong", "name_suffix": "", "institution": "Key Laboratory of South Subtropical Fruit Biology and Genetic Resource Utilization, Ministry of Agriculture, Institute of Fruit Tree Research, Guangdong Academy of Agricultural Science, Guangzhou 510640, China", "department": "None" }, { "first_name": "Chunzhen", "middle_name": "", "last_name": "Cheng", "name_suffix": "", "institution": "Key Laboratory of South Subtropical Fruit Biology and Genetic Resource Utilization, Ministry of Agriculture, Institute of Fruit Tree Research, Guangdong Academy of Agricultural Science, Guangzhou 510640, China", "department": "None" }, { "first_name": "Jiwu", "middle_name": "", "last_name": "Zeng", "name_suffix": "", "institution": "Key Laboratory of South Subtropical Fruit Biology and Genetic Resource Utilization, Ministry of Agriculture, Institute of Fruit Tree Research, Guangdong Academy of Agricultural Science, Guangzhou 510640, China", "department": "None" }, { "first_name": "Guangyan", "middle_name": "", "last_name": "Zhong", "name_suffix": "", "institution": "Key Laboratory of South Subtropical Fruit Biology and Genetic Resource Utilization, Ministry of Agriculture, Institute of Fruit Tree Research, Guangdong Academy of Agricultural Science, Guangzhou 510640, China", "department": "None" }, { "first_name": "Ganjun", "middle_name": "", "last_name": "Yi", "name_suffix": "", "institution": "Key Laboratory of South Subtropical Fruit Biology and Genetic Resource Utilization, Ministry of Agriculture, Institute of Fruit Tree Research, Guangdong Academy of Agricultural Science, Guangzhou 510640, China", "department": "None" } ], "date_submitted": "2014-12-19T01:16:37+01:00", "date_accepted": "2014-12-19T01:16:37+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41337/galley/30936/download/" } ] }, { "pk": 6043, "title": "Grassroots Leaders within the Salvadoran Indigenous Rights Movement", "subtitle": null, "abstract": "Grassroots Leaders within the Salvadoran Indigenous Rights Movement", "language": "en", "license": { "name": "All rights reserved", "short_name": "Copyright", "text": "© the author(s). All rights reserved.", "url": "https://creativecommons.org/licenses/authors" }, "keywords": [], "section": "Articles", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/15q8b8hk", "frozenauthors": [ { "first_name": "Hector", "middle_name": "", "last_name": "Callejas", "name_suffix": "", "institution": "", "department": "None" } ], "date_submitted": "2014-11-23T06:31:53+01:00", "date_accepted": "2014-11-23T06:31:53+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "", "path": "https://journalpub.escholarship.org/our_buj/article/6043/galley/3681/download/" } ] }, { "pk": 63758, "title": "Greg Carter, The United States of the United Races: A Utopian History of Racial Mixing", "subtitle": null, "abstract": "Book review of Greg Carter's \nThe United States of the United Races: A Utopian History of Racial Mixing.", "language": "en", "license": { "name": "", "short_name": "", "text": null, "url": "" }, "keywords": [ { "word": "miscegenation" }, { "word": "intermarriage" }, { "word": "hypodescent" }, { "word": "racially mixed people" }, { "word": "multiracial identity" }, { "word": "mixed race identity" }, { "word": "mixed race studies" }, { "word": "critical mixed race studies" }, { "word": "multiracial studies" }, { "word": "critical multiracial studies" }, { "word": "postracial" }, { "word": "utopian thought." } ], "section": "Book & Media Reviews", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/2dj5d74h", "frozenauthors": [ { "first_name": "Guy", "middle_name": "Emerson", "last_name": "Mount", "name_suffix": "", "institution": "University of Chicago", "department": "" } ], "date_submitted": "2014-01-27T03:53:16+01:00", "date_accepted": "2014-01-27T03:53:16+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/jcmrs/article/63758/galley/48961/download/" } ] }, { "pk": 41230, "title": "Guidelines for Selection of Tissues for Electron Microscopy Confirmation of Candidatus Liberibacter spp. in Huanglongbing-affected Citrus", "subtitle": null, "abstract": "Polymerase chain reaction (PCR) with the pathogen-specific primers and electron microscopy are the two techniques of choice that have been used for detection and identification of \nCandidatus\n Liberibacter spp. in the Huanglongbing (HLB)-affected citrus. Due to the low population and uneven distribution of Liberibacter in the diseased citrus trees finding the bacteria with transmission electron microscopy has been a challenge. Work with samples from HLB-affected citrus during the past 5 years has resulted in certain guidelines for the selection of plant tissues that have led to success in visualization of the bacteria. With PCR-positive field citrus trees, the best source is phloem tissue from seed coats of developing seeds in young fruit supported by leaves with blotchy mottle symptoms. These half mature seeds have been shown to contain large numbers of intact bacteria. However, when working with young potted trees there are usually no fruit to sample. In these trees we had some success in finding bacteria in petioles or midveins of PCR-positive, young developing leaves (2/3 to fully expanded, but not hardened) sampled above leaves showing blotchy mottle symptoms. However, we have found larger numbers of bacteria in roots of the potted diseased trees. We have experienced the most success in sampling root tissue in areas where the phloem has just completed differentiation, in PCR-positive small pioneer and fibrous roots showing primary and secondary growth.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/8cq565ds", "frozenauthors": [ { "first_name": "Diann", "middle_name": "", "last_name": "Achor", "name_suffix": "", "institution": "University of Florida, IFAS, Citrus Research and Education Center, Lake Alfred, FL, USA", "department": "None" }, { "first_name": "Craig", "middle_name": "L.", "last_name": "Davis", "name_suffix": "", "institution": "University of Florida, IFAS, Citrus Research and Education Center, Lake Alfred, FL, USA", "department": "None" }, { "first_name": "Ronald", "middle_name": "H.", "last_name": "Brlansky", "name_suffix": "", "institution": "University of Florida, IFAS, Citrus Research and Education Center, Lake Alfred, FL, USA", "department": "None" }, { "first_name": "Svetlana", "middle_name": "Y.", "last_name": "Folimonova", "name_suffix": "", "institution": "University of Florida, IFAS, Citrus Research and Education Center, Lake Alfred, FL, USA", "department": "None" } ], "date_submitted": "2014-11-20T00:42:46+01:00", "date_accepted": "2014-11-20T00:42:46+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41230/galley/30829/download/" } ] }, { "pk": 45181, "title": "Hardboiled Performance and Affective Intimacy: Remediations of Racism in the Cenk Batu Tatorte", "subtitle": null, "abstract": "Although not around to stay, the first Turkish German detective to be featured in the Germany’s most popular television crime series, \nTatort\n nonetheless represented a major TV event (2008–12). In his sixth episode as an investigator in a series famous for its continued engagement with topical social issues, Cenk Batu would be killed off after his loyalty to the German state had been tested by the schemes of a ruthless killer trying to exploit Batu’s love for a woman. Cast in the role of an undercover agent rather than regular police investigator, Batu’s portrayal more fully tapped into—and reworked—the topoi of the hardboiled genre than did most \nTatort\n detective teams. In this sense, the Batu episodes can be read as a performative remediation of Germany’s heightened debates on Muslim immigration taking place at the intersection of post-September 11 anti-Islam(ist) culturalisms and an established, cross-media tradition of stereotyping Turkish German ‘thug’ masculinity. However, paradigms that deploy performativity as both a critique and reconfiguration of hegemonic discourse only partially capture the nature of the cultural interventions undertaken in these episodes. Via innovative aesthetics that blur the lines between cinema and TV, the Batu episodes also contributed to a twenty-first century visual culture focused on experiences of sensation, perception, and affect. This aesthetics of sensation challenged \nTatort \naudiences to affectively engage with their first Turkish German \nTatort \ninvestigator. In exploring remediations of racism in this context, this article rearticulates established paradigms of performance studies by bringing them into dialogue with recent conceptualizations of affect and of narrativity.", "language": "en", "license": null, "keywords": [ { "word": "remediation, remediations, race, ethnicity, visual culture, special topic, Tatort, performance, performativity, racism, Cenk Batu, Turkish-German, affect, presence, theatricalization, racialized ide.." } ], "section": "Articles", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/7dx4811v", "frozenauthors": [ { "first_name": "Claudia", "middle_name": "", "last_name": "Breger", "name_suffix": "", "institution": "Indiana University Bloomington", "department": "None" } ], "date_submitted": "2014-12-17T14:44:26+01:00", "date_accepted": "2014-12-17T14:44:26+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/transit/article/45181/galley/33971/download/" } ] }, { "pk": 54890, "title": "Hellenistic Jewelry & the Commoditization of Elite Greek Women", "subtitle": null, "abstract": "The paper concentrates on Hellenistic jewelry, which dates from the fourth to first century BCE, and strives to answer the question: how do the different decorative functions of Hellenistic jewelry represent the various roles and social obligations of its elite Greek female wearers? Four thematic parallels exist between jewelry and women, including beauty, sexuality, fertility, and wealth. To examine these connections, this paper studies classical literary sources that focus on female sexuality and the social expectations of women. Examples include segments taken from the \nHomeric Hymn to Aphrodite\n, the poetry of Sappho and Ibycus, an epithalamium, and Plutarch’s \nLife of Demetrius\n. The content of these sources are extracted and compared to the decorative functions of four Hellenistic jewelry pieces, which include an embellished necklace, pair of Eros earrings, diadem, and jewelry set. Based upon the research, physical attributes of Hellenistic jewelry reflect the responsibilities of elite Greek women to groom their appearance, be sexually desirable, produce legitimate heirs, and demonstrate wealth and prestige. By analyzing these similarities, one becomes aware of the extreme commoditization of ancient Greek women.", "language": "en", "license": { "name": "", "short_name": "", "text": null, "url": "" }, "keywords": [ { "word": "Hellenistic" }, { "word": "Jewlery" }, { "word": "Greek Women" }, { "word": "Gender and Sexuality" }, { "word": "Sappho" }, { "word": "Aphrodite" } ], "section": "Articles", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/8s20d5ks", "frozenauthors": [ { "first_name": "Haley", "middle_name": "", "last_name": "Contestabile", "name_suffix": "", "institution": "", "department": "" } ], "date_submitted": "2014-02-07T20:53:29+01:00", "date_accepted": "2014-02-07T20:53:29+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/ucbclassics_bujc/article/54890/galley/41412/download/" } ] }, { "pk": 6031, "title": "Hey Fatty Boom Boom! Fat and Fit in the Uper Palaeolithic", "subtitle": null, "abstract": "Hey Fatty Boom Boom! Fat and Fit in the Uper Palaeolithic", "language": "en", "license": { "name": "All rights reserved", "short_name": "Copyright", "text": "© the author(s). All rights reserved.", "url": "https://creativecommons.org/licenses/authors" }, "keywords": [], "section": "Articles", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/09z0s3k3", "frozenauthors": [ { "first_name": "Suzanne", "middle_name": "", "last_name": "Ubick", "name_suffix": "", "institution": "", "department": "None" } ], "date_submitted": "2014-11-23T06:15:45+01:00", "date_accepted": "2014-11-23T06:15:45+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "", "path": "https://journalpub.escholarship.org/our_buj/article/6031/galley/3669/download/" } ] }, { "pk": 19639, "title": "¿Hispanismo o filipinismo? La identidad cultural en la obra de Nick Joaquin", "subtitle": null, "abstract": "¿Hispanismo o filipinismo? La identidad cultural en la obra de Nick Joaquin", "language": "en", "license": { "name": "none", "short_name": "none", "text": "", "url": "https://escholarship.org/terms" }, "keywords": [], "section": "Article", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/9jh2g0pq", "frozenauthors": [ { "first_name": "Fernando", "middle_name": "N.", "last_name": "Zialcita", "name_suffix": "", "institution": "", "department": "None" } ], "date_submitted": "2014-11-04T19:56:04+01:00", "date_accepted": "2014-11-04T19:56:04+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/transmodernity/article/19639/galley/9726/download/" } ] }, { "pk": 41217, "title": "HLB in Argentina: a New Disease Outbreak", "subtitle": null, "abstract": "Huanglongbing (HLB) caused by Candidatus Liberibacter asiaticus was reported in 2004 in São Paulo, Brazil and three years later in the southern state of Paraná, 300 km away from Argentina’s Northeastern border. In 2009 the Argentine citrus industry (AFINOA and CECNEA) and the institutions MAGyP, SENASA, INTA, INASE, and Obispo Colombres set up a task force to develop quarantine guidelines for prevention of introduction of HLB into Argentine citrus areas. This program is based on measures including 1) border inspections, 2) citrus nursery certification, 3) control on the production, transit and trade of citrus fruit, 4) field survey and diagnosis for the early detection of the disease in trees or the vector \nDiaphorina citri \nin citrus groves, 5) development of research and technology capacity, and 6) communication about the quarantine program and the disease. Diagnostic laboratories were set up in each citrus region and more than 100 inspectors were deployed in different citrus areas for 1) survey of \nDiaphorina citri\n by yellow sticky traps, 2) visual inspection of \nMurraya paniculata\n,\n \n3)\n \ninspection of all citrus nursery production under aphid mesh screen according to Resolution 930/09, and 4) survey of 100 % of the citrus area (150,000 ha) with at least 10 surveys of the highest risk area; There are 52,000 inspection locations for 13,160 tree or Diaphorina samples. In June 2012, a positive detection of HLB was confirmed in a backyard tree in the Northern Misiones Province across the border from Brazil. Since then, 5 surveys were carried out in the area surrounding the focus with the detection of 15 positive trees, all in backyards. The HLB positive trees include 12 tangerines, and 3 Rangpur limes from 7 to more than 10 years old. In all cases, the trees were eradicated by the owner. The psyllid population in this area is very low and all PCR samples of the vector are negative. At present, HLB has not been detected in commercial groves.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/2n97q6t4", "frozenauthors": [ { "first_name": "Y.", "middle_name": "", "last_name": "Outi", "name_suffix": "", "institution": "Senasa, Bs. As. Argentina", "department": "None" }, { "first_name": "P.", "middle_name": "", "last_name": "Cortese", "name_suffix": "", "institution": "Senasa, Bs. As. Argentina", "department": "None" }, { "first_name": "L.", "middle_name": "", "last_name": "Santinoni", "name_suffix": "", "institution": "MAGyP Bs. As.", "department": "None" }, { "first_name": "L.", "middle_name": "", "last_name": "Palma", "name_suffix": "", "institution": "MAGyP Bs. As.", "department": "None" }, { "first_name": "J.", "middle_name": "", "last_name": "Agostini", "name_suffix": "", "institution": "INTA Montecarlo, Mnes. Arg.", "department": "None" }, { "first_name": "C.", "middle_name": "", "last_name": "Preusler", "name_suffix": "", "institution": "INTA Montecarlo, Mnes. Arg.", "department": "None" }, { "first_name": "G.", "middle_name": "", "last_name": "Gastaminza", "name_suffix": "", "institution": "EEA Obispo Colombres, Tucumán, Arg.", "department": "None" }, { "first_name": "G.", "middle_name": "", "last_name": "Perez", "name_suffix": "", "institution": "EEA Obispo Colombres, Tucumán, Arg.", "department": "None" }, { "first_name": "E.", "middle_name": "", "last_name": "Dominguez", "name_suffix": "", "institution": "CECNEA, Cdia. E. Rios Arg.", "department": "None" } ], "date_submitted": "2014-10-09T02:27:38+02:00", "date_accepted": "2014-10-09T02:27:38+02:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41217/galley/30816/download/" } ] }, { "pk": 41366, "title": "HLB Progress on Tahiti acid lime grafted onto eight rootstocks", "subtitle": null, "abstract": "The State of São Paulo is the main Tahiti (Persian) lime producer in Brazil with 65% of 43,000 ha grown in Brazil. In 2003, an experiment was planted in the Citrus Experimental Station (EECB), Bebedouro, Northern São Paulo State, with the objective of characterizing the performance of Tahiti acid lime grafted onto eight rootstocks: Davis A and Flying Dragon trifoliate oranges, Swingle citrumelo, HRS 849 [“citradia 1708” (Argentina trifoliate orange x Smooth Flat Sevile)], Morton citrange, Rangur lime and Volkamer lemon, at 8 x 5 m spacing. In 2004, citrus huanglongbing (HLB), was first reported in the São Paulo State and the trees in the experiment started to show HLB symptoms in 2009. From July 2010 to May 2012, disease severity was evaluated four times and the bacteria titer quantified once. The numbers of qPCR positive replications were in a range of five to eight. Severity data was used to calculate the area under the disease severity progress curve (\nAUDSPC\n)\n.\n The data were analyzed by Fisher LSD test (5%). Flying Dragon and Davis A trifoliate oranges, and Swingle citrumelo, had lower values of \nAUDSPC\n, differing from Morton citrange, Orlando tangelo, Rangpur lime and Volkamer lemon. The citradia HRS 849 [citradia 1708 (Argentina trifoliate orange x Smooth Flat Sevile) had intermediate behavior. The canopies were removed but the rootstocks are still alive, so, new studies using the rootstock’s new shoots and the roots will be done aiming to quantify \nCandidatus\n Liberibacter asiaticus titer in them and to confirm the rootstock’s tolerance identified in the canopies.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/9br769qr", "frozenauthors": [ { "first_name": "E.", "middle_name": "S.", "last_name": "Stuchi", "name_suffix": "", "institution": "Embrapa Cassava & Fruits, Cruz das Almas, Brazil; \nCitrus Experimental Station, Bebedouro, Brazil", "department": "None" }, { "first_name": "E.", "middle_name": "T.", "last_name": "Reiff", "name_suffix": "", "institution": "Citrus Experimental Station, Bebedouro, Brazil", "department": "None" }, { "first_name": "O.", "middle_name": "R.", "last_name": "Sempionato", "name_suffix": "", "institution": "Citrus Experimental Station, Bebedouro, Brazil", "department": "None" }, { "first_name": "L.", "middle_name": "G.", "last_name": "Parolin", "name_suffix": "", "institution": "Citrus Experimental Station, Bebedouro, Brazil", "department": "None" }, { "first_name": "R.", "middle_name": "B.", "last_name": "Bassanezi", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" } ], "date_submitted": "2014-12-23T00:46:39+01:00", "date_accepted": "2014-12-23T00:46:39+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41366/galley/30965/download/" } ] }, { "pk": 41243, "title": "HLB βioMαth: Sentinel network and research", "subtitle": null, "abstract": "The citrus Huanglongbing (HLB), recognized as the most devastating citrus disease worldwide, was detected in Sao Paulo state, Brazil in 2004. The HLB management strategy employed in São Paulo is based on preventing new infections by reducing the inoculum (certified planting seedlings, psyllid control and removal of symptomatic plants). However, HLB continues to disseminate, reaching two neighbor states. In Brazil, citrus is cultivated country-wide (88% of the microregions produce citrus, responding for more than 30% of the planted area). If this dissemination pattern persists, there is a risk of emergence of HLB in areas not yet affected. To face this problem, exclusion strategies and early detection/eradication are crucial, specifically, tools, information and support for the action of phytosanitary defense agencies. The objectives of this Network are generate information that allows to defense phytosanitary agencies prioritize, anticipate or reassess actions relating to the exclusion or eradication of HLB, focusing on preventive actions to areas still unaffected. Since 2010, dataset (presence/absence of vector and bacteria, vector population measurements, etc.) are being obtained from different eco-regions of Brazil: south (cold), northeast (including semi-arid region) and north (amanzon). The analysis of the data until now shows that in the south and north regions the presence of the vector is uncommon or even rare. In contrast, in the northeast the presence is very common, and in the semi-arid region, the vector occurs, but in less abundant and sporadic fashion. Symptomatic plants and insect collected in all regions were tested and did not show the presence of the bacteria.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/1br8t81j", "frozenauthors": [ { "first_name": "F.", "middle_name": "F.", "last_name": "Laranjeira", "name_suffix": "", "institution": "CNPMF/Embrapa Cassava and Fruits, Cruz das Almas, Brazil", "department": "None" }, { "first_name": "E.", "middle_name": "C.", "last_name": "Andrade", "name_suffix": "", "institution": "CNPMF/Embrapa Cassava and Fruits, Cruz das Almas, Brazil", "department": "None" }, { "first_name": "A.", "middle_name": "S.", "last_name": "Nascimento", "name_suffix": "", "institution": "CNPMF/Embrapa Cassava and Fruits, Cruz das Almas, Brazil", "department": "None" }, { "first_name": "C.", "middle_name": "J.", "last_name": "Barbosa", "name_suffix": "", "institution": "CNPMF/Embrapa Cassava and Fruits, Cruz das Almas, Brazil", "department": "None" }, { "first_name": "S.", "middle_name": "X.B.", "last_name": "Silva", "name_suffix": "", "institution": "ADAB/Bahia Agricultural Defense Agency, Salvador, Brazil", "department": "None" }, { "first_name": "J.", "middle_name": "A.", "last_name": "Alencar", "name_suffix": "", "institution": "CPATSA, Petrolina, Brazil", "department": "None" }, { "first_name": "A.", "middle_name": "C.S.", "last_name": "Noronha", "name_suffix": "", "institution": "CPATU, Belem, Brazil", "department": "None" }, { "first_name": "A.", "middle_name": "K.N.", "last_name": "Ishida", "name_suffix": "", "institution": "CPATU, Belem, Brazil", "department": "None" }, { "first_name": "M.", "middle_name": "V.B.", "last_name": "Garcia", "name_suffix": "", "institution": "CPAA, Manaus, Brazil", "department": "None" }, { "first_name": "T.", "middle_name": "B.", "last_name": "Garcia", "name_suffix": "", "institution": "CPAA, Manaus, Brazil", "department": "None" }, { "first_name": "D.", "middle_name": "", "last_name": "Nava", "name_suffix": "", "institution": "CPATC, Pelotas, Brazil", "department": "None" }, { "first_name": "B.", "middle_name": "", "last_name": "Bueno", "name_suffix": "", "institution": "CPATC, Pelotas, Brazil", "department": "None" } ], "date_submitted": "2014-11-25T19:40:41+01:00", "date_accepted": "2014-11-25T19:40:41+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41243/galley/30842/download/" } ] }, { "pk": 41235, "title": "Home Detection Kit for Candidatus Liberibacter asiaticus (LAS) Associated with Citrus Huanglongbing from Psyllids", "subtitle": null, "abstract": "Management of citrus huanglongbing (HLB) requires rapid detection of infected psyllids and trees in an orchard. Detection of HLB associated bacteria (LAS) can be done using psyllids since detection in infected trees is usually delayed (Manjunath et al., 2008). We have developed an easy to use, rapid and affordable detection kit for grower use for testing psyllids for LAS at a reasonable price for initial investment and an operating cost of about $2 per sample.. Eight psyllid samples can be simultaneously tested within 45 minutes. The psyllid DNA extraction and detection of LAS are conducted using a SmartDART™ unit which is operated by software installed on any android device for visualizing real time results. The test results can be e-mailed for both storage and analysis. The DNA prepared can be stored refrigerated and sent to a laboratory for validation. No other equipment (even pipets) is required for the test. The detection system was validated using a large number LAS isolates from many citrus varieties, from different countries; the results were comparable to that of traditional real time PCR data. Development of methods for multiplex detection of the pathogen and the host DNA from both psyllids and plant host are in progress. We believe the detection system will be useful for growers in intra-orchard management, for extension workers, nurserymen, and in areas where the disease has become endemic as well as in those areas where the disease has been recently introduced.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/1fk2088m", "frozenauthors": [ { "first_name": "Manjunath", "middle_name": "L.", "last_name": "Keremane", "name_suffix": "", "institution": "USDA ARS Riverside, CA, USA", "department": "None" }, { "first_name": "Chandrika", "middle_name": "", "last_name": "Ramadugu", "name_suffix": "", "institution": "University of California, Riverside, CA, USA", "department": "None" }, { "first_name": "Ryo", "middle_name": "", "last_name": "Kubota", "name_suffix": "", "institution": "University of Hawaii, Honolulu, HI, USA", "department": "None" }, { "first_name": "Yongping", "middle_name": "", "last_name": "Duan", "name_suffix": "", "institution": "USDA ARS Fort Pierce, FL, USA", "department": "None" }, { "first_name": "David", "middle_name": "", "last_name": "Hall", "name_suffix": "", "institution": "USDA ARS Fort Pierce, FL, USA", "department": "None" }, { "first_name": "Daniel", "middle_name": "", "last_name": "Jenkins", "name_suffix": "", "institution": "University of Hawaii, Honolulu, HI, USA", "department": "None" }, { "first_name": "Richard", "middle_name": "F.", "last_name": "Lee", "name_suffix": "", "institution": "USDA ARS Riverside, CA, USA", "department": "None" } ], "date_submitted": "2014-11-20T00:58:35+01:00", "date_accepted": "2014-11-20T00:58:35+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41235/galley/30834/download/" } ] }, { "pk": 41270, "title": "Huanglongbing management on bearing groves based on favorable periods for symptomatic-trees removal and vector control", "subtitle": null, "abstract": "In Brazil, Huanglongbing (HLB) has been managed by removal of symptomatic-trees and Asian citrus psyllid (ACP) control. Although new HLB-affected trees and ACP can be detected all year long, visual detection of HLB-affected trees has been more pronounced from March to August while ACP population densities are higher from September to February. Therefore, the aim of this work was to compare the efficiency of applying the control strategies only during the higher occurrence periods of new HLB affected trees and ACP adults with the control application during all year long. The experiment was carried out in a 4-yr old sweet orange Valencia/Rangpur lime grove and had a 2 by 3factorial design with 3 replications (1.4 ha plots). The factor “HLB-tree elimination” had 2 treatments: monthly elimination all year long; and monthly elimination from March to August, both based on visual inspection. The factor “Vector control” had 3 treatments: monthly ACP control all year long; monthly ACP control from September to February; and ACP control when 10% of 48 yellow sticky traps (YST) placed in the center of plots had at least one adult psyllid. All Treatments of ACP control were done alternating foliar sprays of Provadoâ, Dimetoatoâ, Trebonâ and Marshalâ+Micromiteâ. After 5 years, no significant differences were detected among different treatments for the variables mean cumulative HLB incidence and disease progress rate estimated by linear regression of the last 4 years cumulative disease incidence. The mean cumulative HLB incidence increased from 0.4% to 14.2% (Yr1 4.9%, Yr2 1.9%, Yr3 2.3%, Yr4 1.7%, and Yr5 3.0%). The number of caught ACP per YST per assessment and the area under the curve of percentage of YST with ACP were significantly higher for monthly ACP control from September to February (total of 34 sprays), but did not differed between monthly ACP control all year long (total of 65 sprays) and control based on ACP monitoring with YST (total of 21 sprays). We believe that HLB management wasn’t better because there was a significant amount of new HLB-symptomatic trees (25.2%) found from December to February, and 12.3% of ACP caught in August. In conclusion, with some adjusts the management of HLB could be optimized according to the favorable periods for HLB-symptomatic trees detection and ACP populations.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/2t01b7zc", "frozenauthors": [ { "first_name": "R.", "middle_name": "B.", "last_name": "Bassanezi", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" }, { "first_name": "L.", "middle_name": "H.", "last_name": "Montesino", "name_suffix": "", "institution": "Fundecitrus, Araraquara, Brazil", "department": "None" }, { "first_name": "A.", "middle_name": "", "last_name": "Bergamin Filho", "name_suffix": "", "institution": "ESALQ/Universidade de São Paulo, Piracicaba, Brazil", "department": "None" } ], "date_submitted": "2014-12-16T23:09:38+01:00", "date_accepted": "2014-12-16T23:09:38+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41270/galley/30869/download/" } ] }, { "pk": 41363, "title": "Huanglongbing Resistance and Tolerance in Citrus", "subtitle": null, "abstract": "Huanglongbing (HLB) is severely impacting Florida citrus. Productivity declines in many HLB-affected genotypes, often with greatly thinned canopies. Fruit size and quality are often adversely affected as the disease advances. HLB was assessed in diverse cultivars in commercial groves with high HLB-incidence. ‘Temple’ had the lowest HLB symptoms and Liberibacter (Las) titer, while ‘Murcott’ and ‘Minneola’ had the highest. The USDA Ft. Pierce, FL farm is managed to reveal genotype responses to HLB. Some current cultivars and hybrid seedlings demonstrate resistance/tolerance, at least to strain(s) of Las present. C. trifoliata is the best documented citrus resistance source with Las titers suppressed even when C. trifoliata is grafted onto severely-infected rootstocks. Some cultivars and hybrids have abundant foliage symptoms, but full canopies and seemingly normal fruit set and size. In 3-years of data from a replicated trial of ‘Triumph’(T), ‘Jackson’(J), ‘Flame’(F), and ‘Marsh’(M), HLB symptoms were severe in all trees and Liberibacter titers were similar. However, F&M were almost completely defoliated in some years while T&J had full canopies. Cumulative fruit/tree was greater for T&J (255&220) than for F&M (29&66). T&J fruit met commercial standards and had normal size but F&M fruit were unacceptable with many small and misshapen. Evidence mounts that useful resistance/tolerance to HLB is present in cultivated citrus and this is a focus of the USDA citrus breeding program.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/59w30753", "frozenauthors": [ { "first_name": "E.", "middle_name": "", "last_name": "Stover", "name_suffix": "", "institution": "USDA/ARS, Ft. Pierce, FL, USA", "department": "None" }, { "first_name": "G.", "middle_name": "", "last_name": "McCollum", "name_suffix": "", "institution": "USDA/ARS, Ft. Pierce, FL, USA", "department": "None" }, { "first_name": "R.", "middle_name": "", "last_name": "Driggers", "name_suffix": "", "institution": "USDA/ARS, Ft. Pierce, FL, USA", "department": "None" }, { "first_name": "Y.", "middle_name": "", "last_name": "Duan", "name_suffix": "", "institution": "USDA/ARS, Ft. Pierce, FL, USA", "department": "None" }, { "first_name": "R.", "middle_name": "", "last_name": "Shatters, Jr.", "name_suffix": "", "institution": "USDA/ARS, Ft. Pierce, FL, USA", "department": "None" }, { "first_name": "M.", "middle_name": "", "last_name": "Ritenour", "name_suffix": "", "institution": "UF/IFAS, IRREC, Ft. Pierce, FL, USA", "department": "None" }, { "first_name": "D.", "middle_name": "G.", "last_name": "Hall", "name_suffix": "", "institution": "USDA/ARS, Ft. Pierce, FL, USA", "department": "None" }, { "first_name": "J.", "middle_name": "", "last_name": "Chaparro", "name_suffix": "", "institution": "UF Hort Sci. Dept., Gainesville, FL, USA", "department": "None" } ], "date_submitted": "2014-12-23T00:41:34+01:00", "date_accepted": "2014-12-23T00:41:34+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41363/galley/30962/download/" } ] }, { "pk": 41219, "title": "Huanglongbing Surveillance Program Actions in the State of Bahia, Brazil", "subtitle": null, "abstract": "Huanglongbing (HLB) is found in South/Southeastern states of Brazil, but citrus is grown all over the country. For that reason, surveillance procedures should be carried out frequently and contingency plans developed. This study reports the actions of the State Bureau of Agricultural Defense of Bahia (ADAB), for a commercial orchard in Bom Jesus da Lapa (state of Bahia, Northeastern Brazil) suspected of having HLB symptomatic plants. Besides having a Contingency Plan, a protocol that establishes actions to detect and eradicate the disease, ADAB is also a partner of the collaborative network HLB BioMath. In August 2012, an ADAB team inspected 22 hectares of three year old orchards of both Pêra sweet orange and Ponkan mandarin. Scouting was performed on total area, and 4.5% of the plants were marked as having HLB-like symptoms. Samples were tested with polymerase chain reaction (PCR) by the Phytopathological Clinic of Sylvio Moreira Citrus Center. The results were negative for HLB bacterium, but a Phytoplasma of 16SrIX Group was found. All symptomatic plants will be eliminated and the surveillance area will be extended. Despite this finding, Bom Jesus da Lapa is 700km away from the most important citrus regions in Bahia: Reconcavo and Litoral Norte. In those regions no suspected plant was ever reported.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [ { "word": "Candidatus Liberibacter, Free Area, Agricultural Defense" } ], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/4tr8c5rx", "frozenauthors": [ { "first_name": "S.", "middle_name": "X.B.", "last_name": "Silva", "name_suffix": "", "institution": "Laboratory of Epidemiology and Health Information Technology; Bahia State Agency of Agricultural Defense (ADAB), Salvador; BA, Brazil", "department": "None" }, { "first_name": "E.", "middle_name": "C.", "last_name": "Andrade", "name_suffix": "", "institution": "Embrapa Cassava & Fruits, Cruz das Almas/BA, Brazil", "department": "None" }, { "first_name": "A.", "middle_name": "S.", "last_name": "Nascimento", "name_suffix": "", "institution": "Embrapa Cassava & Fruits, Cruz das Almas/BA, Brazil", "department": "None" }, { "first_name": "C.", "middle_name": "J.", "last_name": "Barbosa", "name_suffix": "", "institution": "Embrapa Cassava & Fruits, Cruz das Almas; BA, Brazil and Centro de Laboratórios da Agropecuária (CLA), Empresa Baiana de Desenvolvimento Agrícola (EBDA), Salvador; BA, Brazil", "department": "None" }, { "first_name": "E.", "middle_name": "A.", "last_name": "Girardi", "name_suffix": "", "institution": "Embrapa Cassava & Fruits, Cruz das Almas; BA, Brazil", "department": "None" }, { "first_name": "J.", "middle_name": "F.", "last_name": "Astúa", "name_suffix": "", "institution": "Embrapa Cassava & Fruits, Cruz das Almas; BA, Brazil", "department": "None" }, { "first_name": "F.", "middle_name": "F.", "last_name": "Laranjeira", "name_suffix": "", "institution": "Embrapa Cassava & Fruits, Cruz das Almas; BA, Brazil", "department": "None" } ], "date_submitted": "2014-10-09T02:36:08+02:00", "date_accepted": "2014-10-09T02:36:08+02:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41219/galley/30818/download/" } ] }, { "pk": 56472, "title": "Human Rights & South African Constitutionalism: An Interdisciplinary Perspective on Debates over the past Twenty Years", "subtitle": null, "abstract": "[no abstract]", "language": "en", "license": null, "keywords": [], "section": "Essays / Articles Part II: Understanding Post-Apartheid South Africa", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/69b448hb", "frozenauthors": [ { "first_name": "Jonathan", "middle_name": "", "last_name": "Klaaren", "name_suffix": "", "institution": "University of the Witwatersrand School of Law and Humanities at Wiser, WITS", "department": "" } ], "date_submitted": "2014-12-14T04:58:20+01:00", "date_accepted": "2014-12-14T04:58:20+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/ufahamu/article/56472/galley/42880/download/" } ] }, { "pk": 56475, "title": "Ideas Under Arrest: Censorship in South Africa", "subtitle": null, "abstract": "[no abstract]", "language": "en", "license": null, "keywords": [], "section": "Essays/ Articles Part III: Revisited Works", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/20b7v02p", "frozenauthors": [ { "first_name": "Daniel", "middle_name": "P.", "last_name": "Kunene", "name_suffix": "", "institution": "University of Wisconsin-Madison", "department": "" } ], "date_submitted": "2014-12-14T05:08:30+01:00", "date_accepted": "2014-12-14T05:08:30+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/ufahamu/article/56475/galley/42883/download/" } ] }, { "pk": 41295, "title": "Identification and entomopathogenicity of newly-isolated fungi infecting Diaphorina citri Kuwayama (Homotera: Psyllidae) in Murraya orchards of Fujian, China", "subtitle": null, "abstract": "Among fungal isolates obtained from \nMurraya panciculata\n L. groves in Fujian, China, seven were tested pathogenic against the Asian citrus psyllid (ACP), \nDiaphorina citri\n Kuwayama (Homoptera: Psyllidae). In the present paper, the isolates were identified for their taxonomic ranks and compared on their entomopathogenicity against ACP adults. Based on the analysis of conidia morphological data and ITS sequences of 18 S rDNA, the fungal isolates FJAT-9620, FJAT-9621, FJAT-9622, FJAT-9624 and FJAT-9719 were identified as \nBeauveria bassiana\n, FJAT-9623 as \nB. asiatica\n and FJAT-9720 as \nLecanicillium attenuatum\n. Bioassays revealed that fungal isolates FJAT-9622, FJAT-9623, FJAT-9719 and FJAT-9720 infected adult psyllids with mortality of 95.00-98.33% at 27±1oC and 100% relative humidity (RH) in the laboratory. Meanwhile, isolates FJAT-9620, FJAT-9621 and FJAT-9624 induced significantly lower mortality (3.33-40.00%) on the psyllids.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/5xf1z4s9", "frozenauthors": [ { "first_name": "Chuanqing", "middle_name": "", "last_name": "Ruan", "name_suffix": "", "institution": "Agricultural Bio-Resources Research Institute, Fujian Academy of Agricultural Sciences, Fuzhou, Fujian 350003, China", "department": "None" }, { "first_name": "Yulu", "middle_name": "", "last_name": "Xia", "name_suffix": "", "institution": "The Center of Integrated Pest Management, North Carolina State University, NC 27695, USA", "department": "None" }, { "first_name": "Bo", "middle_name": "", "last_name": "Liu", "name_suffix": "", "institution": "Agricultural Bio-Resources Research Institute, Fujian Academy of Agricultural Sciences, Fuzhou, Fujian 350003, China", "department": "None" }, { "first_name": "Jianli", "middle_name": "", "last_name": "Chen", "name_suffix": "", "institution": "Key Laboratory of Biopesticide and Chemical Biology, Ministry of Education, Fujian Agriculture and Forestry University, Fuzhou 350002, Fujian, China", "department": "None" }, { "first_name": "Yujing", "middle_name": "", "last_name": "Zhu", "name_suffix": "", "institution": "Agricultural Bio-Resources Research Institute, Fujian Academy of Agricultural Sciences, Fuzhou, Fujian 350003, China", "department": "None" }, { "first_name": "Guocheng", "middle_name": "", "last_name": "Fan", "name_suffix": "", "institution": "Research Institute of Fruit Sciences, Fujian Academy of Agricultural Sciences, Fuzhou, Fujian 350003, China", "department": "None" }, { "first_name": "Ron", "middle_name": "", "last_name": "Sequeira", "name_suffix": "", "institution": "The United States Department of Agriculture, Animal and Plant Health Inspection Service, Plant Protection and Quarantine, center for plant health science and technology, Raleigh, NC 27606, USA", "department": "None" } ], "date_submitted": "2014-12-17T08:44:05+01:00", "date_accepted": "2014-12-17T08:44:05+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41295/galley/30894/download/" } ] }, { "pk": 41371, "title": "Identification of differentially expressed genes in Citrus sinensis leaves and branches in response to Candidatus Liberibacter asiaticus and Ca. L. americanus", "subtitle": null, "abstract": "Several studies have addressed transcriptional changes in \nCitrus sinensis\n samples in response to \nCandidatus \nLiberibacter asiaticus (CaLas) with the objective to reveal the mechanisms underlying the development of \nHuanglongbing \n(HLB) and identify possible strategies to manage the disease. The aim of this work was to provide data using NGS technology (RNAseq) for a comprehensive analysis of differential expression changes in \nC. sinensis\n leaves and branches induced by HLB, caused either by CaLas or CaLam. Four treatments were evaluated; each of them consisted of RNA bulks extracted from five \nC. sinensis\n HLB symptomatic leaves or branches inoculated with CaLam or CaLas. The samples were subjected to RNAseq sequencing and the differential expression analyses were performed with Cuffdiff. In parallel, we performed a simple parametric test based on the mean and standard deviation to select statistically significant differentially expressed genes (DEG), named RSDA (Relative standard deviation analysis). For this approach, we considered standard deviation values of <0.7, and p-value = 0.01. Several genes associated with disease response, transcription factors involved in the activation of pathways such as the jasmonic acid, salicylic acid and ethylene, as well as genes involved in oxidative stress proved to be differentially expressed in our analyses. In leaves, we identified genes belonging to the WRKY transcription factors, ankyrin repeat family, NB-ARC domain-containing disease resistance, ethylene-forming enzymes and chaperones. In branches, we found many cytochromes, as well as genes involved in callose deposition, AP2/B3 transcriptional factor family and LEA proteins as being differentially expressed. Validation by RT-qPCR was performed for ten DEG.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/32n7n13h", "frozenauthors": [ { "first_name": "M.", "middle_name": "C.", "last_name": "Breton", "name_suffix": "", "institution": "Centro APTA Citros Sylvio Moreira – IAC, Cordeirópolis-SP, Brazil", "department": "None" }, { "first_name": "S.", "middle_name": "S.", "last_name": "Camargo", "name_suffix": "", "institution": "Universidade Federal do Pampa, Bagé-RS, Brazil", "department": "None" }, { "first_name": "L.", "middle_name": "T.", "last_name": "Kishi", "name_suffix": "", "institution": "Universidade Federal de São Carlos, São Carlos-SP, Brazil", "department": "None" }, { "first_name": "M.", "middle_name": "A.", "last_name": "Machado", "name_suffix": "", "institution": "Centro APTA Citros Sylvio Moreira – IAC, Cordeirópolis-SP, Brazil", "department": "None" }, { "first_name": "J.", "middle_name": "", "last_name": "Freitas-Astúa", "name_suffix": "", "institution": "Centro APTA Citros Sylvio Moreira – IAC, Cordeirópolis-SP, Brazil;\nEmbrapa Cassava and Fruits, Cruz das Almas-BA, Brazil", "department": "None" } ], "date_submitted": "2014-12-23T01:00:42+01:00", "date_accepted": "2014-12-23T01:00:42+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41371/galley/30970/download/" } ] }, { "pk": 41357, "title": "Identification of small molecule inhibitors against SecA of Candidatus Liberibacter asiaticus by structure based design", "subtitle": null, "abstract": "Huanglongbing is the most devastating disease of citrus caused by \nCandidatus\n Liberibacter asiaticus (Las) (1, 2). In the present study, we report the discovery of novel small molecule inhibitors against SecA ATPase of Las by using structure based design methods. We built the homology model of SecA protein structure of Las based on the SecA of \nEscherichia coli\n. The model was used for \nin-silico\n screening of commercially available compounds from ZINC database. Using the glide flexible molecular docking method, twenty structures were chosen for \nin vitro\n studies. Five compounds were found to inhibit the ATPase activity of SecA of Las at nano molar concentrations and showed antimicrobial activities against \nAgrobacterium tumefaciens\n with MBC ranging from 128 to 256 g/mL. These compounds appear to be suitable as lead compounds for further development of antimicrobial compounds against Las. To test the application potential of those compounds on plants, the phytotoxicity studies were performed on the five compounds against citrus. In addition, we are optimizing these five antimicrobial compounds to identify compounds higher antimicrobial activity.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/9k6712tj", "frozenauthors": [ { "first_name": "Nagaraju", "middle_name": "", "last_name": "Akula", "name_suffix": "", "institution": "Citrus Research & Education Center, Department of Microbiology and Cell Science, University of Florida, 700 Experiment Station Rd., Lake Alfred, FL 33850, USA", "department": "None" }, { "first_name": "Pankaj", "middle_name": "", "last_name": "Trivedi", "name_suffix": "", "institution": "Citrus Research & Education Center, Department of Microbiology and Cell Science, University of Florida, 700 Experiment Station Rd., Lake Alfred, FL 33850, USA", "department": "None" }, { "first_name": "Frank", "middle_name": "Q.", "last_name": "Han", "name_suffix": "", "institution": "Structure Based Design, Inc., 6048 Cornerstone Court West, Suite D, San Diego, CA 92121, USA", "department": "None" }, { "first_name": "Nian", "middle_name": "", "last_name": "Wang", "name_suffix": "", "institution": "Citrus Research & Education Center, Department of Microbiology and Cell Science, University of Florida, 700 Experiment Station Rd., Lake Alfred, FL 33850, USA", "department": "None" } ], "date_submitted": "2014-12-20T03:46:05+01:00", "date_accepted": "2014-12-20T03:46:05+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41357/galley/30956/download/" } ] }, { "pk": 6035, "title": "Identity at the Fringes of Citizenship: Experiences of Afghan Refugees in Turkey", "subtitle": null, "abstract": "Identity at the Fringes of Citizenship: Experiences of Afghan Refugees in Turkey", "language": "en", "license": { "name": "All rights reserved", "short_name": "Copyright", "text": "© the author(s). All rights reserved.", "url": "https://creativecommons.org/licenses/authors" }, "keywords": [], "section": "Articles", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/7p13s23f", "frozenauthors": [ { "first_name": "Kamyar", "middle_name": "", "last_name": "Jarahzadeh", "name_suffix": "", "institution": "", "department": "None" } ], "date_submitted": "2014-11-23T06:20:55+01:00", "date_accepted": "2014-11-23T06:20:55+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "", "path": "https://journalpub.escholarship.org/our_buj/article/6035/galley/3673/download/" } ] }, { "pk": 52619, "title": "Implications of Mystic Intoxication in Chinese and Iranian Poetry", "subtitle": null, "abstract": "", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "<p>Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use. No additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.</p>", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [ { "word": "History" }, { "word": "China" }, { "word": "Iran" }, { "word": "Comparative History" }, { "word": "Poetry: Intoxication" } ], "section": "Articles", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/56m0j6zp", "frozenauthors": [ { "first_name": "Rebecca", "middle_name": "", "last_name": "Weston", "name_suffix": "", "institution": "UC Merced", "department": "" } ], "date_submitted": "2014-05-15T20:24:06+02:00", "date_accepted": "2014-05-15T20:24:06+02:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/ssha_uhj/article/52619/galley/39675/download/" } ] }, { "pk": 41356, "title": "Improved methods for genome sequencing of Liberibacters by BAC library-based metagenomics approach", "subtitle": null, "abstract": "Liberibacters have not yet been successfully cultured; their minimal genomes carry multiple copies of several genes. Sequences identical to phage genomes have been found in many Liberibacters. Available evidences suggest that the Liberibacter genomes are adapting rapidly in different hosts and environments. Characterization of genomes of rapidly changing unculturable organisms can be challenging. We have used a model system based on \nCandidatus\n Liberibacter psyllaurous associated with tomato “psyllid yellows” (Hansen et al., 2008) to develop methodologies using alternate techniques for sequencing metagenomes. We have constructed a BAC library from infected tomato psyllids (\nBactericera cockerelli\n). The library consists of 57,600 clones arrayed in 150 plates each with 384 wells. DNA from individual clones were pooled for screening purposes. Initial identification of clones with Liberibacter sequences were conducted based on 16s ribosomal sequences, and contiguous clones were characterized by end sequencing and identified as containing Liberibacter genome fragments. Screening of additional clones from the library was based on probes developed on such sequences. A total of 245 clones with Liberibacter genome fragments have been identified. A total of 63 bar-coded BAC clones were sequenced by using Roche 454 technology. BAC clones from this library contain large inserts (average size 70 kb). Similarities and differences with other well characterized genomes of Liberibacters (Duan et al., 2009, Lin et al., 2011) will be presented.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/66f7q63z", "frozenauthors": [ { "first_name": "Manjunath", "middle_name": "L.", "last_name": "Keremane", "name_suffix": "", "institution": "USDA ARS, National Clonal Germplasm Repository for Citrus and Dates, Riverside, CA, USA, 92507", "department": "None" }, { "first_name": "Chandrika", "middle_name": "", "last_name": "Ramadugu", "name_suffix": "", "institution": "Dept. of Botany and Plant Sciences, University of California, Riverside, CA, USA 92511", "department": "None" }, { "first_name": "Yongping", "middle_name": "", "last_name": "Duan", "name_suffix": "", "institution": "US Horticultural Research Laboratory, Fort Pierce, FL, USA 34945", "department": "None" }, { "first_name": "Lijuan", "middle_name": "", "last_name": "Zhou", "name_suffix": "", "institution": "US Horticultural Research Laboratory, Fort Pierce, FL, USA 34945", "department": "None" }, { "first_name": "Greg", "middle_name": "", "last_name": "Kund", "name_suffix": "", "institution": "Dept. of Entomology, University of California, Riverside, CA, USA 92511", "department": "None" }, { "first_name": "John", "middle_name": "", "last_name": "Trumble", "name_suffix": "", "institution": "Dept. of Entomology, University of California, Riverside, CA, USA 92511", "department": "None" }, { "first_name": "Richard", "middle_name": "", "last_name": "Lee", "name_suffix": "", "institution": "USDA ARS, National Clonal Germplasm Repository for Citrus and Dates, Riverside, CA, USA, 92507", "department": "None" } ], "date_submitted": "2014-12-20T03:43:48+01:00", "date_accepted": "2014-12-20T03:43:48+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41356/galley/30955/download/" } ] }, { "pk": 41220, "title": "Incidence of Huanglongbing in commercial orchards in northwest Paraná, Brazil", "subtitle": null, "abstract": "In the Parana state, Brazil, Huanglongbing has been advancing on the most important production areas. In this study the objective was monitoring the disease incidence in sweet orange varieties Pera, Valencia and Folha Murcha (leaf wilt) in commercial orchards in the northwest of the Parana state. The plants were grouped by age and management of the insect vector, Diaphorina citri, in 35 commercial orchards. Every three months a full assessment of the orchard was performed, totaling six evaluations in each orchard. This monitoring consisted of the walk in the street, or with platform, throughout the orchard, observing and noting the plants symptomatic for the disease. Orchards of Pera variety had a higher incidence of the disease when the plants were aged 0-5 years and in orchards over the age of 11 years and chemical management of psyllid was made only when their presence was detected. Pera orchards of ages 6 to 10 years and above 11 years, when the chemical management of insect occurred only by new shoots and without assessing the presence of the insect, also showed a higher incidence. The Folha Murcha was the variety with the lowest disease incidence, except when chemical management occurred without assessing the presence of the psyllid in orchards aged 6 to 10 years and above 11 years, and when insecticide applications were made every 20 days, without any evaluation of the presence of the vector.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/5322n0hk", "frozenauthors": [ { "first_name": "F.", "middle_name": "", "last_name": "Mulati", "name_suffix": "", "institution": "Nucleo de Pesquisa em Biotecnologia Aplicada-NBA, Universidade Estadual de Maringa - UEM, Maringa-PR, Brazil", "department": "None" }, { "first_name": "P.", "middle_name": "T.R.", "last_name": "Nocchi", "name_suffix": "", "institution": "Nucleo de Pesquisa em Biotecnologia Aplicada-NBA, Universidade Estadual de Maringa - UEM, Maringa-PR, Brazil", "department": "None" }, { "first_name": "C.", "middle_name": "A.", "last_name": "Zanutto", "name_suffix": "", "institution": "Nucleo de Pesquisa em Biotecnologia Aplicada-NBA, Universidade Estadual de Maringa - UEM, Maringa-PR, Brazil", "department": "None" }, { "first_name": "J.", "middle_name": "", "last_name": "Belasque Jr.", "name_suffix": "", "institution": "Fundecitrus, Araraquara, SP, Brazil", "department": "None" }, { "first_name": "W.", "middle_name": "M.C.", "last_name": "Nunes", "name_suffix": "", "institution": "Nucleo de Pesquisa em Biotecnologia Aplicada-NBA, Universidade Estadual de Maringa - UEM, Maringa-PR, Brazil", "department": "None" } ], "date_submitted": "2014-10-09T02:40:52+02:00", "date_accepted": "2014-10-09T02:40:52+02:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41220/galley/30819/download/" } ] }, { "pk": 41361, "title": "Increases in ‘Candidatus Liberibacter asiaticus’ viability and investigations of biofilm-like structures in citrus juice medium", "subtitle": null, "abstract": "Huanglongbing disease of citrus, associated with infection by the bacterium ‘\nCandidatus \nLiberibacter asiaticus’ (LAS), has spread rapidly in the US since 2005. Attempts to culture LAS \nin vitro\n have not yielded a consistently reproducible culture method; therefore, obtaining knowledge about the infection process is difficult. To determine conditions which sustain LAS viability, LAS inoculum obtained from seeds of fruit from infected pomelo trees (\nCitrus grandis\n ‘Mato Buntan’) was added to different media, and cell viability was monitored for several weeks using quantitative polymerase chain reaction (qPCR) in conjunction with ethidium monoazide (EMA). Among media tested, King’s B (K) did not support viability of LAS cells, while grapefruit juice (G) allowed LAS cells to survive \nin vitro\n for ~20 days. In media that sustained LAS viability, a reproducible biofilm-like substance was formed over time at the air-liquid interface of culture flasks and glass slides inserted in cultures. Fluorescence \nin situ\n hybridization (FISH) showed the biofilm contains aggregates of LAS cells, which was confirmed by qPCR. 16S rDNA libraries of the biofilm samples have been constructed and will be sequenced via Illumina next-generation sequencing to determine their bacterial composition. To elucidate why juice-based media prolongs LAS viability, the elemental nutrient compositions of the media and the biofilm were analyzed via inductively coupled plasma optical emission spectrometry (ICP-OES). Compositions were compared, and specific elements, such as potassium and calcium, were more abundant in media that sustain LAS cell viability. Results will contribute to future development of a culture medium for LAS.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/8kd104hn", "frozenauthors": [ { "first_name": "J.", "middle_name": "K.", "last_name": "Parker", "name_suffix": "", "institution": "Auburn University, Auburn, AL, USA", "department": "None" }, { "first_name": "S.", "middle_name": "R.", "last_name": "Wisotsky", "name_suffix": "", "institution": "Auburn University, Auburn, AL, USA", "department": "None" }, { "first_name": "M.", "middle_name": "E.", "last_name": "Hilf", "name_suffix": "", "institution": "USDA-ARS, Fort Pierce, FL, USA", "department": "None" }, { "first_name": "K.", "middle_name": "R.", "last_name": "Sims", "name_suffix": "", "institution": "USDA-ARS, Fort Pierce, FL, USA", "department": "None" }, { "first_name": "P.", "middle_name": "A.", "last_name": "Cobine", "name_suffix": "", "institution": "Auburn University, Auburn, AL, USA", "department": "None" }, { "first_name": "L.", "middle_name": "", "last_name": "De La Fuente", "name_suffix": "", "institution": "Auburn University, Auburn, AL, USA", "department": "None" } ], "date_submitted": "2014-12-20T04:27:50+01:00", "date_accepted": "2014-12-20T04:27:50+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41361/galley/30960/download/" } ] }, { "pk": 41258, "title": "Induced release of a plant-defense volatile ‘deceptively’ attracts insect vectors to plants infected with a bacterial pathogen", "subtitle": null, "abstract": "In this investigation, we experimentally demonstrated specific mechanisms through which a bacterial plant pathogen induces plant responses that modify behavior of its insect vector. \nCandidatus \nLiberibacter asiaticus, a fastidious, phloem-limited bacterium responsible for causing huanglongbing disease of citrus, induced release of a specific volatile chemical, methyl salicylate, which increased attractiveness of infected plants to its insect vector, Asian citrus psyllid (\nDiaphorina citri\n), and caused vectors to initially prefer infected plants. However, the insect vectors subsequently dispersed to non-infected plants as their preferred location of prolonged settling because of likely sub-optimal nutritional content of infected plants. The duration of initial feeding on infected plants was sufficiently long for the vectors to acquire the pathogen before they dispersed to non-infected plants, suggesting that the bacterial pathogen manipulates behavior of its insect vector to promote its own proliferation. The behavior of psyllids in response to infected versus non-infected plants was not influenced by whether or not they were carriers of the pathogen and was similar under both light and dark conditions. Feeding on citrus by \nD. citri\n adults also induced the release of methyl salicylate, suggesting that it may be a cue revealing location of conspecifics on host plants. Collectively, our results suggest that host selection behavior of \nD. citri\n may be modified by bacterial infection of plants, which alters release of specific headspace volatiles and plant nutritional contents. Furthermore, we show in a laboratory setting that this apparent pathogen-mediated manipulation of vector behavior may facilitate pathogen spread.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/11q675g8", "frozenauthors": [ { "first_name": "Lukasz", "middle_name": "L.", "last_name": "Stelinski", "name_suffix": "", "institution": "University of Florida, Entomology and Nematology Department, Citrus Research and Education Center, 700 Experiment Station Road, Lake Alfred, FL, 33850, USA", "department": "None" }, { "first_name": "Rajinder", "middle_name": "S.", "last_name": "Mann", "name_suffix": "", "institution": "University of Florida, Entomology and Nematology Department, Citrus Research and Education Center, 700 Experiment Station Road, Lake Alfred, FL, 33850, USA", "department": "None" }, { "first_name": "Jared", "middle_name": "G.", "last_name": "Ali", "name_suffix": "", "institution": "University of Florida, Entomology and Nematology Department, Citrus Research and Education Center, 700 Experiment Station Road, Lake Alfred, FL, 33850, USA", "department": "None" }, { "first_name": "Sara", "middle_name": "L.", "last_name": "Hermann", "name_suffix": "", "institution": "University of Florida, Entomology and Nematology Department, Citrus Research and Education Center, 700 Experiment Station Road, Lake Alfred, FL, 33850, USA", "department": "None" }, { "first_name": "Siddharth", "middle_name": "", "last_name": "Tiwari", "name_suffix": "", "institution": "University of Florida, Entomology and Nematology Department, Citrus Research and Education Center, 700 Experiment Station Road, Lake Alfred, FL, 33850, USA", "department": "None" }, { "first_name": "Kirsten", "middle_name": "S.", "last_name": "Pelz-Stelinski", "name_suffix": "", "institution": "University of Florida, Entomology and Nematology Department, Citrus Research and Education Center, 700 Experiment Station Road, Lake Alfred, FL, 33850, USA", "department": "None" }, { "first_name": "Hans", "middle_name": "T.", "last_name": "Alborn", "name_suffix": "", "institution": "Center for Medical, Agricultural, and Veterinary Entomology, Agricultural Research Service, U.S. Department of Agriculture, Gainesville, FL 32608, USA", "department": "None" } ], "date_submitted": "2014-11-25T21:35:34+01:00", "date_accepted": "2014-11-25T21:35:34+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41258/galley/30857/download/" } ] }, { "pk": 41319, "title": "In-Field Thermal Treatment of Huanglongbing (HLB) infected Trees", "subtitle": null, "abstract": "To decrease \nCandidatus\n Liberibacter asiaticus titer and increase the productive life of infected trees, thermal treatment of orange trees was proposed. A moving greenhouse was developed to cover single trees during the summer of 2012. Four trees (~ 2.5×2.5×2.5 m) were treated, one tree per day, during the months of September (trees T1 through T3) and October (tree T4). From each tree, three symptomatic branches were sampled to determine microbial kill before (0 h) and at 2, 3, 4, and 5 h during the treatment. Temperature distribution throughout the canopy and on the sampled branches was also recorded. Maximal temperatures in the ranges 50 to 53 °C were reached at the top (2.4 m) of the canopy whereas at the bottom of the canopy (i.e., 0.6 m) maximal temperatures ranged from 36 to 43 °C. Due to varied micro-meteorological conditions during the treatment, temperatures of the T1 through T4 sampled branches reached above 40⁰C for 217, 166, 35, 228 min, respectively. For T1, T2 and T4 trees, average temperatures of the sampled branches reached above 45 °C for 87, 35, and 49 min or more. Attempts to quantitatively determine microbial kill by determining percent live bacteria at selected time intervals during thermal treatment was unreliable due to the very uneven distribution of initial proportion of live-to-dead bacteria and analysis variability. However, overall, after thermal treatments, live microbial populations decreased. These findings indicate that adequate thermal treatment of trees required forced convection air flow and supplemental heating.", "language": "en", "license": { "name": "Creative Commons Attribution 4.0", "short_name": "CC BY 4.0", "text": "Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.\n\nNo additional restrictions — You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits.", "url": "https://creativecommons.org/licenses/by/4.0" }, "keywords": [], "section": "Abstracts of Presentations at the 3rd International Research Conference on Huanglongbing", "is_remote": true, "remote_url": "https://escholarship.org/uc/item/3cq8n4fv", "frozenauthors": [ { "first_name": "L.", "middle_name": "R.", "last_name": "Khot", "name_suffix": "", "institution": "Citrus Research and Education Center, IFAS, University of Florida, 700 Experiment Station Road, Lake Alfred, FL 33850, USA", "department": "None" }, { "first_name": "S.", "middle_name": "E.", "last_name": "Jones", "name_suffix": "", "institution": "Citrus Research and Education Center, IFAS, University of Florida, 700 Experiment Station Road, Lake Alfred, FL 33850, USA", "department": "None" }, { "first_name": "P.", "middle_name": "", "last_name": "Trivedi", "name_suffix": "", "institution": "Citrus Research and Education Center, IFAS, University of Florida, 700 Experiment Station Road, Lake Alfred, FL 33850, USA", "department": "None" }, { "first_name": "M.", "middle_name": "R.", "last_name": "Ehsani", "name_suffix": "", "institution": "Citrus Research and Education Center, IFAS, University of Florida, 700 Experiment Station Road, Lake Alfred, FL 33850, USA", "department": "None" }, { "first_name": "N.", "middle_name": "", "last_name": "Wang", "name_suffix": "", "institution": "Citrus Research and Education Center, IFAS, University of Florida, 700 Experiment Station Road, Lake Alfred, FL 33850, USA", "department": "None" }, { "first_name": "J.", "middle_name": "I.", "last_name": "Reyes-De-Corcuera", "name_suffix": "", "institution": "Citrus Research and Education Center, IFAS, University of Florida, 700 Experiment Station Road, Lake Alfred, FL 33850, USA", "department": "None" } ], "date_submitted": "2014-12-17T23:52:32+01:00", "date_accepted": "2014-12-17T23:52:32+01:00", "date_published": "2014-01-01T01:00:00+01:00", "render_galley": null, "galleys": [ { "label": "", "type": "pdf", "path": "https://journalpub.escholarship.org/iocv_journalcitruspathology/article/41319/galley/30918/download/" } ] } ] }